UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_021082
NM_001145998
XM_005247722
XM_005247723
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_021082 [Chr.3(+): 121613171-121663034 GRCh37]
Id:SLC15A2_exon16
Position:Chr.3(+): 121647764-121648065 GRCh37
Chr.3(+): 123130454-123130755 NCBI36
Sequence:
ATCGTGATGTCCAATATGGAGTAGAAGGTGTACGTGACCTTCATTTTATATTCTTCATTTTACAGAAAACACCACACTAT
TCCAAACTGCACCTGAAAACAAAAAGCCAGGATTTTCACTTCCACCTGAAATATCACAATTTGTCTCTCTACACTGAGC
A
TTCTGTGCAGGAGAAGAACTGGTACAGTCTTGTCATTCGTGAAGATGGGAACAGTATCTCCAGCATGATGGTAATTTGAG
GAATTGCCTGTGTTTTCAGTTGTCATCTCAAAGTAATATGACTGTCTCATCAACATCTTACC
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: SLC15A2_16_DHPLC
SLC15A2_16_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 16: Coding
4070
PDE
121647923 GRCh37
123130613 NCBI36
15891436
CACAATTTGTCTCTCTACACTGAGC A → C TTCTGTGCAGGAGAAGAACTGGTAC
+479
His → Pro
(D=77)
n=
A/A=
A/C=
C/C=
C=
200
100
0
0
0.000
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 16: Coding
4071
PDE
121647930 GRCh37
123130620 NCBI36
15961443
TGTCTCTCTACACTGAGCATTCTGT G → T CAGGAGAAGAACTGGTACAGTCTTG
+481
Val = Val
n=
G/G=
G/T=
T/T=
T=
200
98
2
0
0.010
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.