UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_021082
NM_001145998
XM_005247722
XM_005247723
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_021082 [Chr.3(+): 121613171-121663034 GRCh37]
Id:SLC15A2_exon17
Position:Chr.3(+): 121648074-121648263 GRCh37
Chr.3(+): 123130764-123130953 NCBI36
Sequence:
GCCTGATGATCAAATTTTCTGAGTATAGGTCTTATTTCATCAGCTGTTACTGATTTTTACTTTCCTCTGTTGTAGGTAAA
GGATACAGAAAGCA
AAACAACCAATGGGATGACAACCGTGAGGTTTGAATGTCAATGAGATTCCAGGCCACTCTGTTTTC
TTGAATCTTGGATCTCTTCTAATCTTTGGG
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: SLC15A2_17_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 
4072
PDE
121648140 GRCh37
123130830 NCBI36
  
AGCTGTTACTGATTTTTACTTTCCT C → T TGTTGTAGGTAAAGGATACAGAAAG
+ 
 
n=
C/C=
C/T=
T/T=
T=
196
98
0
0
0.000
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 17: Coding
4073
PDE
1 pubI
121648168 GRCh37
123130858 NCBI36
16791526
TTGTAGGTAAAGGATACAGAAAGCA A → G AACAACCAATGGGATGACAACCGTG
PEPT2*1 (350L-409P-509R) showed lower Km for glycyl-sarcosine compared to PEPT2*2 (350F-409S-509K) in transfected cells. PMID: 19940846.
+509
Lys → Arg
(D=26)
n=
A/A=
A/G=
G/G=
G=
196
27
51
20
0.464
200
23
50
27
0.520
60
13
12
5
0.367
20
3
0
7
0.700
14
0
4
3
0.714
Set-I
 
4074
PDE
121648234 GRCh37
123130924 NCBI36
  
TGAGATTCCAGGCCACTCTGTTTTC T → C TGAATCTTGGATCTCTTCTAATCTT
+ 
 
n=
T/T=
T/C=
C/C=
C=
196
96
2
0
0.010
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.