UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_021082
NM_001145998
XM_005247722
XM_005247723
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_021082 [Chr.3(+): 121613171-121663034 GRCh37]
Id:SLC15A2_exon19
Position:Chr.3(+): 121650420-121650648 GRCh37
Chr.3(+): 123133110-123133338 NCBI36
Sequence:
ACCTGGAGATGGGAATGCTTTTCCAAGCCTTGATATTTATTCTAACCTAAATTCATCCTGTTCCAGATACCCTGCAGTGC
ACTGTAGAACAGAAGATAAGAACTTTTCTCTGAATTTGGGTCTTCTAGACTTTGGTGCAGCATATCTGTTTGTTATTACT
AAT
GTAAGTAGCTCACAGCCACCTCTTTACCCTCTCTCCATATACATATATCTCCTGGGATCCTCTAGG
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: SLC15A2_19_DHPLC
SLC15A2_19_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 
4075
PDE
121650611 GRCh37
123133301 NCBI36
  
AGTAGCTCACAGCCACCTCTTTACC C → A TCTCTCCATATACATATATCTCCTG
+ 
 
n=
C/C=
C/A=
A/A=
A=
200
100
0
0
0.000
200
100
0
0
0.000
60
29
1
0
0.017
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 
4076
PDE
121650623 GRCh37
123133313 NCBI36
  
CCACCTCTTTACCCTCTCTCCATAT A → C CATATATCTCCTGGGATCCTCTAGG
+ 
 
n=
A/A=
A/C=
C/C=
C=
200
100
0
0
0.000
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.