UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_021082
NM_001145998
XM_005247722
XM_005247723
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_021082 [Chr.3(+): 121613171-121663034 GRCh37]
Id:SLC15A2_exon20
Position:Chr.3(+): 121658108-121658405 GRCh37
Chr.3(+): 123140798-123141095 NCBI36
Sequence:
GGATGGATATAAGATCGTAGAATGCTGTAGTTAGAAATATTTACTTGAGACTACTGACAAGTCCATTTCCATTTTCTCTT
TCCCTAAGAACACCAATCAGGGTCTTCAGGCCTGGAAGATTGAAGACATTCCAGCCAACAAAATGTCCATTGCGTGGCAG
CTACCACAATATGCCCTGGTTACAGCTGGGGAGGTCATGTTCTCTGTCACAGGTCTTGAGTTTTCTTATTCTCAG
GTAAG
TTTTTGCAAATAGAAGGTAGAAATTGAGACATTGCTTGAAGGACAATGAATTTTAATT
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: SLC15A2_20_DHPLC
SLC15A2_20_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 
4077
PDE
IA
121658376 GRCh37
123141066 NCBI36
  
TTGCAAATAGAAGGTAGAAATTGAG A → G CATTGCTTGAAGGACAATGAATTTT
+ 
 
n=
A/A=
A/G=
G/G=
G=
200
93
2
5
0.060
200
93
0
7
0.070
60
26
0
4
0.133
20
10
0
0
0.000
14
6
0
1
0.143
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.