UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_021082
NM_001145998
XM_005247722
XM_005247723
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_021082 [Chr.3(+): 121613171-121663034 GRCh37]
Id:SLC15A2_exon22
Position:Chr.3(+): 121659603-121659898 GRCh37
Chr.3(+): 123142293-123142588 NCBI36
Sequence:
CCACTCCTCATCCTGTAAAGATCTCTTTAGTTTCAGGTTTCTCCATATTCTTCTCATATTTATTTCCCCCTGCAGTGGGC
CGAATTCATTTTGTTTTCCTGCCTCCTGCTGGTGATCTGCCTGATCTTCTCCATCATGGGCTACTACTATGTTCCTGTAA
AGACAGAGGATATGCGGGGTCCAGCAGATAAGCACATTCCTCACATCCAGGGGAACATGATCAAACTAGAGACCAAGAAG
ACAAAACTCTGA
TGACTTCCTAGATTCTGTCCTGACCCCAATTCCTGGCCCTGTCT
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: SLC15A2_22_DHPLC
SLC15A2_22_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 22: 3UTR
4080
PDE
I
121659860 GRCh37
123142550 NCBI36
2349 
CCAAGAAGACAAAACTCTGATGACT T → C CCTAGATTCTGTCCTGACCCCAATT
+ 
 
n=
T/T=
T/C=
C/C=
C=
200
89
9
2
0.065
200
87
0
13
0.130
60
26
0
4
0.133
20
8
0
2
0.200
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.