UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_021082
NM_001145998
XM_005247722
XM_005247723
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_021082 [Chr.3(+): 121613171-121663034 GRCh37]
Id:SLC15A2_exon10-11
Position:Chr.3(+): 121641824-121642188 GRCh37
Chr.3(+): 123124514-123124878 NCBI36
Sequence:
TTAAGCAAGAAAGCCATGTACAGAACTTCTAGCATTTCTGCCCATTCTTCCTCCTTTTCGCAGAAGCAGCTCATTATGGA
TGTAAAGGCA
CTGACCAGGGTACTATTCCTTTATATCCCATTGCCCATGTTCTGGGCTCTTTTGGATCAGCAGGTAAGAA
TAGTTCTTTTGGACATTACCGCTCCTTACAGCCACTTCCCTCTCACAGGAAAGGGATTTCTCATTACAGGATCTGTTTGC
CCTAGGGTTCACGATGGACTTTGCAAGCCATCAGGATGAATAGGAATTTGGTGAGTAGAAGAGATTTTCCAGAGAAGTCT
ATTATTTTCTTCATCATCCATATTGGGGAAAAATTAATTTCTTTG
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: SLC15A2_10-11_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 10: Coding
4081
PDE
121641914 GRCh37
123124604 NCBI36
1048895
GCAGCTCATTATGGATGTAAAGGCA C → T TGACCAGGGTACTATTCCTTTATAT
+299
Leu = Leu
n=
C/C=
C/T=
T/T=
T=
200
99
1
0
0.005
200
100
0
0
0.000
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 
4082
PDE
121642048 GRCh37
123124738 NCBI36
  
CTCTCACAGGAAAGGGATTTCTCAT T → A ACAGGATCTGTTTGCCCTAGGGTTC
+ 
 
n=
T/T=
T/A=
A/A=
A=
200
28
51
21
0.465
200
23
50
27
0.520
58
12
13
4
0.362
20
3
0
7
0.700
14
0
4
3
0.714
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.