UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_004915
NM_016818
NM_207174
NM_207627
NM_207628
NM_207629
XM_005261209
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_004915 [Chr.21(+): 43639267-43717354 GRCh37]
Id:ABCG1-P SEQ
Position:Chr.21(+): 43638717-43639467 GRCh37
Chr.21(+): 42511786-42512536 NCBI36
Sequence:
TGCCAGGGGTCACCCCACACCGGTGCTGTTGGGGGCGTTGGAGTGGTTATCTCTTCTTTAGTCCTCAAGCTCCTACCTGG
CAGAGAGCTGCCCAACACCGTCGGGGTGGGGTGGGCGGGAAGGGAAGAAGCAGCAGCAAGAAAGAAGCCCCCTGGCCCTC
ACTCTCCCTCCCTGGACGCCCCCTCTTCGACCCCATCACACAGCCGCTTGAGGCTTGGAGGCAGTGGATTTCCGAGCCTG
GGAACCCCGGCGTCTGTCCGGTGTCCCCGCAGCCTCACCCGTGCTGGCCCAGCCCCCGCGAGTTCGGGACCCGGGGTTTC
CGGGGTGGCAGGGGGTTCCCATGCCGCCTGCGAGGCCTCGGCTCGGGCCGCTCCCGGAACCTGCACTTCAGGGGTCCTGG
TCCGCCGCCCCCAGCAGGAGCAAAACAAGAGCACGCGCACCTGCCGGCCCGCCCGCCCCCTTGGTGCCGGCCAATCGCGC
GCTCGGGGCGGGGTCGGGCGCGCTGGAACCAGAGCCGGAGCCGGATCCCAGCCGGAGCCCAAGCGCAGCCCGCACCCCGC
GCAGCGGCTGAGCCGGGAGCCAGCGCAGCCTCGGCCCCGCAGCTCAAGCCTCGTCCCCGCCGCCGCCGCCGCCGCCGCCG
CCGCCGCCCCCGGGGC
ATGGCCTGTCTGATGGCCGCTTTCTCGGTCGGCACCGCCATGGTGAGTGAGCGCATCCTTCGTC
CGCCGGGAACGGTTTTATTTTCAAGGAGAGC
Color Legend: SNP  UTR  CODING
Sample Sets: PMT-272
Assays: ABCG1-P
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 
4290
PDE
1 pubI
43638855 GRCh37
42511924 NCBI36
-412-518
GGCGGGAAGGGAAGAAGCAGCAGCA A → G GAAAGAAGCCCCCTGGCCCTCACTC
+ 
 
n=
A/A=
A/G=
G/G=
G=
130
64
1
0
0.008
118
46
11
2
0.127
132
49
15
2
0.144
122
49
12
0
0.098
PMT-272
 
4291
PDE
43638949 GRCh37
42512018 NCBI36
-318-424
TTGAGGCTTGGAGGCAGTGGATTTC C → T GAGCCTGGGAACCCCGGCGTCTGTC
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
62
3
0
0.023
118
59
0
0
0.000
132
66
0
0
0.000
122
61
0
0
0.000
PMT-272
 
4292
PDE
43639009 GRCh37
42512078 NCBI36
-258-364
CGCAGCCTCACCCGTGCTGGCCCAG C → T CCCCGCGAGTTCGGGACCCGGGGTT
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
65
0
0
0.000
118
59
0
0
0.000
132
66
0
0
0.000
122
60
1
0
0.008
PMT-272
Promoter
4293
PDE
4 pubs
43639018 GRCh37
42512087 NCBI36
-249-355
ACCCGTGCTGGCCCAGCCCCCGCGA G → A TTCGGGACCCGGGGTTTCCGGGGTG
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
57
3
5
0.100
118
42
11
6
0.195
132
38
10
18
0.348
122
35
17
9
0.287
PMT-272
Promoter
4294
PDE
43639028 GRCh37
42512097 NCBI36
-239-345
GCCCAGCCCCCGCGAGTTCGGGACC C → T GGGGTTTCCGGGGTGGCAGGGGGTT
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
65
0
0
0.000
118
59
0
0
0.000
132
66
0
0
0.000
122
60
1
0
0.008
PMT-272
Promoter
4295
PDE
43639161 GRCh37
42512230 NCBI36
-106-212
GCAAAACAAGAGCACGCGCACCTGC C → T GGCCCGCCCGCCCCCTTGGTGCCGG
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
65
0
0
0.000
118
59
0
0
0.000
132
65
1
0
0.008
122
61
0
0
0.000
PMT-272
Promoter
4296
PDE
43639168 GRCh37
42512237 NCBI36
-99-205
AAGAGCACGCGCACCTGCCGGCCCG C → A CCGCCCCCTTGGTGCCGGCCAATCG
+ 
 
n=
C/C=
C/A=
A/A=
A=
130
64
1
0
0.008
118
51
8
0
0.068
132
66
0
0
0.000
122
57
4
0
0.033
PMT-272
Promoter
4297
PDE
43639250 GRCh37
42512319 NCBI36
-17-123
CCAGAGCCGGAGCCGGATCCCAGCC G → C GAGCCCAAGCGCAGCCCGCACCCCG
+ 
 
n=
G/G=
G/C=
C/C=
C=
130
64
1
0
0.008
118
59
0
0
0.000
132
66
0
0
0.000
122
61
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.