UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_002858
NM_001122674
XM_005271088
XM_005271090
XM_005271087
XM_005271089
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_002858 [Chr.1(+): 94883933-94984219 GRCh37]
Id:ABCD3-P SEQ
Position:Chr.1(+): 94883411-94884161 GRCh37
Chr.1(+): 94655999-94656749 NCBI36
Sequence:
TGGCTTGGAAAAAGCTCTTTGATCTGTGTCATTCTCCTCACATCTCCCTACACCTCTGCGGAGTTCCGATTGTTTGGTTT
CGTCCT
GATAATCACTGTGCTGTGTTTTCCCTACACGCTCTGTGACGGGGCCGTCCGCCTCCTTCCTGGGCTCCTTTAAG
AGGGTGGTAACGGTACATCACCGCGGGAGTGGAGAGGCAGGGCCCACTAGGTCGTCGCTGCAGGCCAGGCCCGCTCATCC
AGTTATTGTGAAAGCCGGGGTGTGCGCGCGAAGAGTGGGAGGGTAGGGGTGAGGCAGGGGCAGCACTGACGCCTCGCAGG
GCTGAGTAGCAACAGCTCCTCCGCGCCGCGTTTCCGGAGACCCTGAAGGAGTCCGCGCGTGCGCAGAGCGCGTCCCGGGA
ACTGTTCCGCCCACGGAGGCTGCCGAGCGCGCTCCCGCCGGGCCAAAGTACAAAGTGGGCTCCAGAGCGCGGGCGGCGCG
GCGGCGCGAGCCAGGGGGCGGTCCTGCGCGGCCGGCCCCGCCCTCTGCTCTCCTCCCAGTCTCCCCCGCGCTGCGTGCAG
TAAGGTAGCCGCCGCCGCCGCCGC
CGCCGCGTCCCCTCGCCGGCTCGCTGGTACCGGCAGTGCCATGGCGGCCTTCAGCA
AGTACTTGACGGCGCGAAACTCCTCGCTGGCTGGTGCCGCGTTCCTGCTGCTCTGCCTGCTCCACAAGCGGCGCCGCGCC
CTCGGCCTGCAC
GGGTAAGAAGGCCCGTAGC
Color Legend: SNP  UTR  CODING
Sample Sets: PMT-272
Assays: ABCD3-P
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
Promoter
4315
PDE
94883882 GRCh37
94656470 NCBI36
-51-153
AGTACAAAGTGGGCTCCAGAGCGCG G → A GCGGCGCGGCGGCGCGAGCCAGGGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
66
0
0
0.000
128
64
0
0
0.000
136
67
1
0
0.007
130
65
0
0
0.000
PMT-272
Promoter
4316
PDE
94883914 GRCh37
94656502 NCBI36
-19-121
CGGCGGCGCGAGCCAGGGGGCGGTC C → T TGCGCGGCCGGCCCCGCCCTCTGCT
+ 
 
n=
C/C=
C/T=
T/T=
T=
132
65
1
0
0.008
128
64
0
0
0.000
136
68
0
0
0.000
130
65
0
0
0.000
PMT-272
Exon 1: 5UTR
4317
PDE
94883995 GRCh37
94656583 NCBI36
63-40

C → CGCCGC, T
GTAAGGTAGCCGCCGCCGCCGCCGC C → CGCCGC GCCGCGTCCCCTCGCCGGCTCGCTG
GTAAGGTAGCCGCCGCCGCCGCCGC C → T GCCGCGTCCCCTCGCCGGCTCGCTG
+ 

 
 
 
n=
C/C=
C/CGCCGC=
CGCCGC/CGCCGC=
C/T=
T/T=
CGCCGC/T=
CGCCGC=
T=
132
61
5
0
0
0
0
0.038
0.000
128
55
2
0
7
0
0
0.016
0.055
136
45
2
0
16
5
0
0.015
0.191
130
57
2
0
5
1
0
0.015
0.054
PMT-272
Exon 1: 5UTR
4318
PDE
94883999 GRCh37
94656587 NCBI36
67-36
GGTAGCCGCCGCCGCCGCCGCCGCC G → T CGTCCCCTCGCCGGCTCGCTGGTAC
+ 
 
n=
G/G=
G/T=
T/T=
T=
132
60
5
1
0.053
128
64
0
0
0.000
136
68
0
0
0.000
130
65
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.