UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_004790
NM_153276
NM_153277
NM_153278
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_004790 [Chr.11(-): 62744069-62752495 GRCh37]
Id:SLC22A6_exon1
Position:Chr.11(-): 62751738-62752232 GRCh37
Chr.11(-): 62508314-62508808 NCBI36
Sequence:
GCAGGCAGACAGACAGAGGTCCTGGGACTGGAAGGCCTCAGCCCCCAGCCACTGGGCTGGGCCTGGCCCAATGGCCTTTA
ATGACCTCCTGCAGCAGGTGGGGGGTGTCGGCCGCTTCCAGCAGATCCAGGTCACCCTGGTGGTCCTCCCCCTGCTCCTG
ATGGCTTCTCACAACACCCTGCAGAACTTCACTGCTGCCATCCCTACCCACCACTGCC
GCCCGCCTGCCGATGCCAACCT
CAGCAAGAA
CGGGGGGCTGGAGGTCTGGCTGCCCCGGGACAGGCAGGGGCAGCCTGAGTCCTGCCTCCGCTTCACCTCCC
C
GCAGTGGGGACTGCCCTTTCTCAATGGCACAGAAGCCAATGGCACAGGGGCCACAGAGCCCTGCACCGATGGCTGGATC
TATGACAACAGCACCTTCCC
ATCTACCATCGTGACTGAGGTGAGCACCTGGGGCTCCCCATCCAGGGGCCAAGATGGGAA
GATGGGGGCCTTTGT
Color Legend: SNP  UTR  CODING
Sample Sets: Set-II
Assays: SLC22A6_1_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 1: 5UTR
4693
PDE
62752182 GRCh37
62508758 NCBI36
314-20
GACTGGAAGGCCTCAGCCCCCAGCC A → G CTGGGCTGGGCCTGGCCCAATGGCC
- 
 
n=
A/A=
A/G=
G/G=
G=
158
39
31
9
0.310
160
63
16
1
0.113
118
28
25
6
0.314
100
36
12
2
0.160
12
4
1
1
0.250
Set-II
Exon 1: Coding
4694
PDE
1 pub
62752014 GRCh37
62508590 NCBI36
482149
GCTGCCATCCCTACCCACCACTGCC G → A CCCGCCTGCCGATGCCAACCTCAGC
-50
Arg → His
(D=29)
n=
G/G=
G/A=
A/A=
A=
158
74
5
0
0.032
160
80
0
0
0.000
120
60
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
Exon 1: Coding
4695
PDE
I
62751983 GRCh37
62508559 NCBI36
513180
CTGCCGATGCCAACCTCAGCAAGAA C → T GGGGGGCTGGAGGTCTGGCTGCCCC
-60
Asn = Asn
n=
C/C=
C/T=
T/T=
T=
158
79
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
12
5
1
0
0.083
Set-II
Exon 1: Coding
4696
PDE
62751977 GRCh37
62508553 NCBI36
519186
ATGCCAACCTCAGCAAGAACGGGGG G → A CTGGAGGTCTGGCTGCCCCGGGACA
-62
Gly = Gly
n=
G/G=
G/A=
A/A=
A=
158
79
0
0
0.000
160
79
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 1: Coding
4697
PDE
I
62751911 GRCh37
62508487 NCBI36
585252
AGTCCTGCCTCCGCTTCACCTCCCC G → T CAGTGGGGACTGCCCTTTCTCAATG
-84
Pro = Pro
n=
G/G=
G/T=
T/T=
T=
158
75
4
0
0.025
160
68
12
0
0.075
120
58
2
0
0.017
100
48
2
0
0.020
12
6
0
0
0.000
Set-II
Exon 1: Coding
4698
PDE
I
62751852 GRCh37
62508428 NCBI36
644311
GCCAATGGCACAGGGGCCACAGAGC C → T CTGCACCGATGGCTGGATCTATGAC
-104
Pro → Leu
(D=98)
n=
C/C=
C/T=
T/T=
T=
158
78
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 1: Coding
4699
PDE
62751812 GRCh37
62508388 NCBI36
684351
GGATCTATGACAACAGCACCTTCCC A → G TCTACCATCGTGACTGAGGTGAGCA
-117
Pro = Pro
n=
A/A=
A/G=
G/G=
G=
158
75
4
0
0.025
160
68
12
0
0.075
120
58
2
0
0.017
100
48
2
0
0.020
12
6
0
0
0.000
Set-II

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.