UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_004790
NM_153276
NM_153277
NM_153278
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_004790 [Chr.11(-): 62744069-62752495 GRCh37]
Id:SLC22A6_exon2
Position:Chr.11(-): 62751223-62751666 GRCh37
Chr.11(-): 62507799-62508242 NCBI36
Sequence:
GCTCTCAGCTGTCAGGACCAGAGAGGCAAAGGGCAAAGTGCCGGAGGAAGAGGGTGACATGGACCCCAGAGGACCAGCTG
AAGTGGGGGAAGGGGATTCTCTGAAGCCAGGCTCATCTCTGCCTGACCCTTGCTCCTCTCCCCACAGTGGGACCTTGTGT
GCTCTCACAGGGCCCTACGCCAGCTGGCCCAGTCCTTGTACATGGTGGGGGTGCTGCTCGGAGCCATGGTGTTCGGCTAC
CTTGCAGACAG
GTCAGTCCTGGGTAGGGTCAAGGGGCTGGGCTGGGCTGGGATTAGGGGCTCAGCTGGGCTCAGGGTGTC
TAGGTGGGAGCTTGGCATTGCCAGCCGGCGCTGGTTTGAGGATCTACAGCACCAGCCTCATACTTCAGAGGTCCTCAAAA
GGCCCCAGCCCAGGCATCATCCAGGGTGAGCCCTCCTCTCCTGG
Color Legend: SNP  UTR  CODING
Sample Sets: Set-II
Assays: SLC22A6_2_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 
4700
PDE
62751551 GRCh37
62508127 NCBI36
  
AGGGGATTCTCTGAAGCCAGGCTCA T → C CTCTGCCTGACCCTTGCTCCTCTCC
- 
 
n=
T/T=
T/C=
C/C=
C=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
98
49
0
0
0.000
12
6
0
0
0.000
Set-II

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.