UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:ABC1
HGNC Symbol:ABCA1
HGNC Description:ATP-binding cassette, sub-family A (ABC1), member 1
HGNC ID:29
Superfamily:ABC
Chromosome:Chr.9(-): 107543283-107690527 GRCh37
Location:9q31.1
OMIM:600046
OMIM Phenotype:Tangier disease; High density lipoprotein deficiency, type 2; Tangier disease, variant; High density lipoprotein deficiency; Coronary heart disease in familial hypercholesterolema, protection aganist
Accessions:NM_005502
Nucleotide RefSeq:NM_005502
Protein RefSeq:NP_005493
Entrez:19
Ensembl:ENSG00000165029
Isoforms:9
Evidence:Substrate In Vitro Evidence: 1. Free Cholesterol Efflux - Using J774 macrophages - Kellner-Weibel G, Atherosclerosis 2003: 235-243 2. Phospholipid efflux - Oram JF, Current Opinion in Lipidology 2002, 373-381 3. Interleukin 1-beta transport in Macrophages, but not monocytes from normal and TD patients- Xiaoqin Zhou et al, Biochemical and Biophysical Research Communications, 2002: 598-604 4. Apolipoprotein E secretion from monocyte-derived macrophages- Von Eckardstein A et al, FASEB, 2001: 1555-1561 Substrate In Vivo Evidence: 1. Atherogenesis, Tangier's Disease, Familial Hypoalphalipopreteinemia (FHA) - Singaraja RR et al, Ateriosclerosis Thrombosis and Vascular Biology 2003: 1322-1332 2. Apoptotic cell Engulfment by macrophages - Broccando C et al, Biochimica et Biophysica Acta, 1999: 395-404 3. ABCA1 modulates the development of aortic atherosclerosis in C57BL/6 and apoE-knockout mice, Joyce CW et al, PNAS 2002: 407-412 4. Glyburide inhibits ApoE secretion - Von Eckardstein A et al, FASEB, 2001: 1555-1561 Tissue Distribution Evidence: 1. Macrophages 2. Liver 3. Lymph node 4. Adrenals 5. Uterus 6. Low in Brain and Lung By Northern Blot Reference: C. Broccardo et al, Biochimia et Biophysica Acta 1461 (1999) 395-404
Tissues:Macrophages, liver, lymph nodes, adrenals, uterus
Type:protein-coding
Sets:IV
PharmGKB ID:PA24373
HPRD ID:02501
Substrates:Free cholesterol, phospholipids, ApoE
Trivial Names:TGD, ABC1, CERP, ABC-1, HDLDT1
Transcripts:NM_005502.3 [Chr.9(-): 107543283-107690527 GRCh37]
XM_005251773.1 [Chr.9(-): 107543283-107690436 GRCh37]
XM_005251776.1 [Chr.9(-): 107543283-107690434 GRCh37]
XM_005251774.1 [Chr.9(-): 107543283-107668279 GRCh37]
XM_005251775.1 [Chr.9(-): 107543283-107651743 GRCh37]
XM_005251779.1 [Chr.9(-): 107543283-107617522 GRCh37]
XM_005251778.1 [Chr.9(-): 107548590-107690436 GRCh37]
XM_005251777.1 [Chr.9(-): 107550097-107690436 GRCh37]
XM_005251780.1 [Chr.9(-): 107561731-107690436 GRCh37]
ENST00000374733 [Chr.9(-): 107623719-107690420 GRCh37]
ENST00000374736 [Chr.9(-): 107543283-107690518 GRCh37]
ENST00000423487 [Chr.9(-): 107617847-107690420 GRCh37]
ENST00000494467 [Chr.9(-): 107587872-107593270 GRCh37]
Annotation History:View Events (66)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for ABCA1.

Variant Data

View all PMT variants for ABCA1 on UCSC Genome Browser
Showing SNP features for transcript:   
ABCA1 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:ABCA1 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
PromoterPDE3 pubs
107690733 GRCh37
106730554 NCBI36
-206-24773
CCAGCGCTTCCCGCGCGTCTTAGGC C → T GGCGGGCCCGGGCGGGGGAAGGGGA
- 
 
n=
C/C=
C/T=
T/T=
T=
134
60
7
0
0.052
136
40
23
5
0.243
132
30
31
5
0.311
124
42
18
2
0.177
PMT-272
PromoterPDE10 pubs
107690709 GRCh37
106730530 NCBI36
-182-24749
CCGGCGGGCCCGGGCGGGGGAAGGG G → C ACGCAGACCGCGGACCCTAAGACAC
- 
 
n=
G/G=
G/C=
C/C=
C=
134
24
29
14
0.425
136
13
36
19
0.544
132
20
31
15
0.462
124
12
37
13
0.508
PMT-272
Promoter
107690655 GRCh37
106730476 NCBI36
-128-24695
CTGTACCCTCCACCCCCACCCCACC C → CCACCC ACCTCCCCCCAACTCCCTAGATGTG
- 
 
n=
C/C=
C/CCACCC=
CCACCC/CCACCC=
CCACCC=
134
60
7
0
0.052
136
45
23
0
0.169
132
35
31
0
0.235
124
44
18
0
0.145
PMT-272
PromoterPDE1 pub
107690541 GRCh37
106730362 NCBI36
-14-24581
GTGACTGAACTACATAAACAGAGGC C → T GGGAAGGGGGCGGGGAGGAGGGAGA
- 
 
n=
C/C=
C/T=
T/T=
T=
120
57
3
0
0.025
90
45
0
0
0.000
70
35
0
0
0.000
88
43
1
0
0.011
PMT-272
PromoterPDE9 pubsI
107690535 GRCh37
106730356 NCBI36
-8-24575
GAACTACATAAACAGAGGCCGGGAA G → C GGGGCGGGGAGGAGGGAGAGCACAG
- 
 
n=
G/G=
G/C=
C/C=
C=
120
45
14
1
0.133
90
24
14
7
0.311
70
18
15
2
0.271
88
20
18
6
0.341
PMT-272
Exon 1: 5UTRPDE18 pubsI
107690450 GRCh37
106730271 NCBI36
78-24490
GCCGAATCTATAAAAGGAACTAGTC C → T CGGCAAAAACCCCGTAATTGCGAGC
- 
 
n=
C/C=
C/T=
T/T=
T=
120
41
16
3
0.183
90
24
14
7
0.311
70
28
2
5
0.171
88
24
16
4
0.273
PMT-272
Exon 50: CodingPDE
107546653 GRCh37
106586474 NCBI36
71336729
GTAGAAAAGATGTGAGAACTGCAAC G → T TCCACTACTGTCTGGTTTTTGTGTA
+2243
Asp → Glu
(D=45)
n=
G/G=
G/T=
T/T=
T=
136
63
5
0
0.037
136
68
0
0
0.000
132
66
0
0
0.000
134
67
0
0
0.000
PMT-272
Exon 50: 3UTRPDE
107546500 GRCh37
106586321 NCBI36
7286 
CAGTATCCAGTTTACTTCTTCCCAC A → G TCAACTTCTGGCTCTTTTCTCCACA
+ 
 
n=
A/A=
A/G=
G/G=
G=
136
66
2
0
0.015
136
68
0
0
0.000
132
66
0
0
0.000
134
67
0
0
0.000
PMT-272
Exon 50: 3UTRPDE
107546228 GRCh37
106586049 NCBI36
7558 
TTTGATCAATAATCGCTGGCCATGA T → C TACTTGATGAATTATTGTTGCAACC
+ 
 
n=
T/T=
T/C=
C/C=
C=
136
68
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
PMT-272
Exon 50: 3UTRPDE
107546201 GRCh37
106586022 NCBI36
7585 
GAATGAGGATGTGCATTACCTTTTG A → T TTTTGATCAATAATCGCTGGCCATG
+ 
 
n=
A/A=
A/T=
T/T=
T=
136
51
16
1
0.132
136
67
1
0
0.007
136
65
3
0
0.022
136
67
1
0
0.007
PMT-272
Exon 50: 3UTRPDE
107546180 GRCh37
106586001 NCBI36
7606 
CTGGGCATGGCATGGCTTAGTGAAT G → A AGGATGTGCATTACCTTTTGATTTT
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 50: 3UTRPDEI
107545903 GRCh37
106585724 NCBI36
7883 
CAATGGAACCAAGTTTCCCGTGCCT G → A GAGACACCCACATTTTTGTTGCATG
+ 
 
n=
G/G=
G/A=
A/A=
A=
134
25
29
13
0.410
136
28
36
4
0.324
136
2
22
44
0.809
136
20
34
14
0.456
PMT-272
Exon 50: 3UTR
107545010 GRCh37
106584831 NCBI36
8776 
AAGCCAATTATTTGAAGGTACTAAA T → C GCCATAAACACAAGTTGTGTTTTTC
+ 
 
n=
T/T=
T/C=
C/C=
C=
134
67
0
0
0.000
136
68
0
0
0.000
134
66
1
0
0.007
136
68
0
0
0.000
PMT-272
Exon 50: 3UTR
107544943 GRCh37
106584764 NCBI36
8843 
TTGACTAGTGATTGAAGAGATGAAA A → T ATTTGAGACTGTCAGATTTAATGGG
+ 
 
n=
A/A=
A/T=
T/T=
T=
134
50
16
1
0.134
136
67
1
0
0.007
134
64
3
0
0.022
136
67
1
0
0.007
PMT-272
Exon 50: 3UTR2 pubsI
107544700 GRCh37
106584521 NCBI36
9086 
CACCTTTAGCGTTAATATTCAAATT C → T TGGAAAAAGTGGAAGAAGTTAGTAA
+ 
 
n=
C/C=
C/T=
T/T=
T=
134
0
13
54
0.903
136
4
19
45
0.801
134
2
15
50
0.858
136
1
14
53
0.882
PMT-272
Exon 50: 3UTRI
107544685 GRCh37
106584506 NCBI36
9101 
AAATCTGAAGTCTTACACCTTTAGC G → A TTAATATTCAAATTCTGGAAAAAGT
+ 
 
n=
G/G=
G/A=
A/A=
A=
134
52
14
1
0.119
136
68
0
0
0.000
134
41
19
7
0.246
136
63
5
0
0.037
PMT-272
Exon 50: 3UTR
107544673 GRCh37
106584494 NCBI36
9113 
AAGATTAATTTGAAATCTGAAGTCT T → G ACACCTTTAGCGTTAATATTCAAAT
+ 
 
n=
T/T=
T/G=
G/G=
G=
134
66
1
0
0.007
136
65
3
0
0.022
134
67
0
0
0.000
136
64
4
0
0.029
PMT-272
Exon 50: 3UTR
107544286 GRCh37
106584107 NCBI36
9500 
TCCTTTCAATCTGTATTAAAATGTT G → A TGTTTTCTTCAAAATAGTTCACAGT
+ 
 
n=
G/G=
G/A=
A/A=
A=
134
67
0
0
0.000
132
66
0
0
0.000
134
66
1
0
0.007
134
67
0
0
0.000
PMT-272
Exon 50: 3UTRI
107544285 GRCh37
106584106 NCBI36
9501 
GTCCTTTCAATCTGTATTAAAATGT T → C GTGTTTTCTTCAAAATAGTTCACAG
+ 
 
n=
T/T=
T/C=
C/C=
C=
134
59
8
0
0.060
132
41
24
1
0.197
134
30
27
10
0.351
134
46
19
2
0.172
PMT-272
Exon 50: 3UTR
107544057 GRCh37
106583878 NCBI36
9729 
AGATGCAAAAGCAGAAATTTTTGAA C → G ACGTATTTTGAGAATTTCTGAAACT
+ 
 
n=
C/C=
C/G=
G/G=
G=
134
67
0
0
0.000
132
66
0
0
0.000
134
66
1
0
0.007
134
67
0
0
0.000
PMT-272
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
Exon 50: 3UTRPDE
107543891 GRCh37
106583712 NCBI36
9895 
AGTCACAAAGCATTTGCTTTCAGTA C → T AGATAATGAAATACAGTAGTGTGAG
+ 
 
n=
C/C=
C/T=
T/T=
T=
134
62
5
0
0.037
132
66
0
0
0.000
134
67
0
0
0.000
134
67
0
0
0.000
PMT-272
Exon 50: 3UTR
107543699 GRCh37
106583520 NCBI36
10087 
TTACATTATTACTAGTAGATAATAA CAA → - GGGTACAAATTAATGTCTCAATA
+ 
 
n=
CAA/CAA=
CAA/-=
-/-=
-=
128
48
15
1
0.133
132
52
14
0
0.106
134
42
23
2
0.201
136
43
22
3
0.206
PMT-272
Exon 50: 3UTRPDE
107543696 GRCh37
106583517 NCBI36
10090 
GTATTACATTATTACTAGTAGATAA T → C AACAAGGGTACAAATTAATGTCTCA
+ 
 
n=
T/T=
T/C=
C/C=
C=
128
63
1
0
0.008
132
66
0
0
0.000
134
67
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 50: 3UTRPDE
107543513 GRCh37
106583334 NCBI36
10273 
ATAGATCCCATTACAGACAGCGTAA A → G GTGCTTGGAATGAGGGCCAATGATG
+ 
 
n=
A/A=
A/G=
G/G=
G=
128
61
3
0
0.023
132
66
0
0
0.000
134
67
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 50: 3UTRPDE
107543376 GRCh37
106583197 NCBI36
10410 
CATTTTAATACTTCATATAAAGTTA T → C TGACATACAAAATTTTTTTTCTTTT
+ 
 
n=
T/T=
T/C=
C/C=
C=
128
62
2
0
0.016
132
60
6
0
0.045
134
67
0
0
0.000
136
66
2
0
0.015
PMT-272
Exon 50: 3UTRPDE
107543342 GRCh37
106583163 NCBI36
10444 
TTTGTGACTCATTATATTACAACAT A → G GAAATATGCATTTTAATACTTCATA
+ 
 
n=
A/A=
A/G=
G/G=
G=
128
64
0
0
0.000
132
66
0
0
0.000
134
66
1
0
0.007
136
68
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.