UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:ABCA10
HGNC Symbol:ABCA10
HGNC Description:ATP-binding cassette, sub-family A (ABC1), member 10
HGNC ID:30
Superfamily:ABC
Chromosome:Chr.17(-): 67144148-67240956 GRCh37
Location:17q24
OMIM:612508
OMIM Phenotype:None
Accessions:AL832004,AY028900
Nucleotide RefSeq:NM_080282
Protein RefSeq:NP_525021
Entrez:10349
Ensembl:ENSG00000154263
Isoforms:2
Evidence:Substrate In Vivo Evidence: 1. ABCA10 was cloned from human macrophages. Seven SNPs identified in ABCA10 transcripts. High amino acid sequence homology with ABCA6, ABCA8, and ABCA9. ABCA10 is a cholesterol-responsive gene (expression is suppressed by cholesterol import). Suggested role in macrophage lippid homeostasis. Wenzel, JJ et al. Biochem Biophys Res Comm 2003 Jul 11, 306(4):1089-98 PMID 12821155. Tissue Distribution Evidence: 1. RNA dot blot showed highest expression in heart, brain, and GI tract. Wenzel, JJ et al. Biochem Biophys Res Comm 2003 Jul 11, 306(4):1089-98 PMID 12821155.
Tissues:heart, brain, GI tract
Type:protein-coding
Sets:0
PharmGKB ID:PA24374
HPRD ID:12400
Substrates:unknown
Trivial Names:EST698739
Transcripts:NM_080282.3 [Chr.17(-): 67144148-67240956 GRCh37]
XM_005256933.1 [Chr.17(-): 67144148-67221912 GRCh37]
ENST00000269081 [Chr.17(-): 67144148-67240987 GRCh37]
ENST00000416101 [Chr.17(-): 67144148-67240956 GRCh37]
ENST00000423818 [Chr.17(-): 67215833-67224818 GRCh37]
ENST00000432313 [Chr.17(-): 67192500-67240956 GRCh37]
ENST00000518929 [Chr.17(-): 67144733-67221583 GRCh37]
ENST00000519732 [Chr.17(-): 67144640-67171922 GRCh37]
ENST00000521526 [Chr.17(-): 67218819-67224841 GRCh37]
ENST00000521538 [Chr.17(-): 67143360-67146204 GRCh37]
ENST00000522406 [Chr.17(-): 67144149-67224796 GRCh37]
ENST00000522787 [Chr.17(-): 67143355-67146203 GRCh37]
ENST00000523419 [Chr.17(-): 67144733-67221583 GRCh37]
ENST00000523512 [Chr.17(-): 67210845-67224818 GRCh37]
ENST00000524231 [Chr.17(-): 67144321-67146593 GRCh37]
ENST00000524273 [Chr.17(-): 67210913-67218754 GRCh37]
ENST00000588514 [Chr.17(-): 67144886-67145464 GRCh37]

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for ABCA10.

Variant Data

View all PMT variants for ABCA10 on UCSC Genome Browser
Showing SNP features for transcript:   
ABCA10 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:ABCA10 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
PromoterPDE
67241142 GRCh37
64752737 NCBI36
-186-19643
ACAGGGCCAAAACTGATAGTCATCC G → A AGTTCTCTCCAAAGAATCCATTTCT
+ 
 
n=
G/G=
G/A=
A/A=
A=
96
48
0
0
0.000
84
42
0
0
0.000
106
53
0
0
0.000
132
65
1
0
0.008
PMT-272
Promoter
67241033 GRCh37
64752628 NCBI36
-77-19534
TAGTTAGTTATATAAAATAATAGCT AGTTATATA → - AGTTATATAAGTAATAT
+ 
 
n=
AGTTATATA/AGTTATATA=
AGTTATATA/-=
-/-=
-=
96
48
0
0
0.000
84
39
3
0
0.036
106
53
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 1: 5UTRPDE
67240868 GRCh37
64752463 NCBI36
89-19369
AATACAGTATGGTATTTTAACAAAC T → C CAGGGCACAATTAGAATGAAGTTTT
+ 
 
n=
T/T=
T/C=
C/C=
C=
96
47
1
0
0.010
84
42
0
0
0.000
106
53
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 1: 5UTRPDE
67240750 GRCh37
64752345 NCBI36
207-19251
TAGGAAATAAGCTATTTCAGGAAAG A → G AAATAAAAAATCAATGTTAGCAAAT
+ 
 
n=
A/A=
A/G=
G/G=
G=
96
44
4
0
0.042
84
42
0
0
0.000
106
53
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 1: 5UTRPDE
67240695 GRCh37
64752290 NCBI36
262-19196
CTGATAAGAATAGCTGATATAAAAA T → C TATTCATCTGAGAATAAATTCTTTC
+ 
 
n=
T/T=
T/C=
C/C=
C=
96
47
1
0
0.010
84
42
0
0
0.000
106
53
0
0
0.000
132
66
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.