UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:LI2
HGNC Symbol:ABCA12
HGNC Description:ATP-binding cassette, sub-family A (ABC1), member 12
HGNC ID:14637
Superfamily:ABC
Chromosome:Chr.2(-): 215796266-216003151 GRCh37
Location:2q34
OMIM:607800
OMIM Phenotype:Ichthyosis, lamellar 2
Accessions:AK096597,AY033486,AY219711
Nucleotide RefSeq:NM_173076
Protein RefSeq:NP_775099
Entrez:26154
Ensembl:ENSG00000144452
Isoforms:2
Evidence:Substrate In Vivo Evidence: 1. Mutations associated with Lamellar ichthyosis type 2, Lefevre C et al, Human Molecular Genetics, 2003: 2369-78 Tissue Distribution Evidence: 1. Lung, testis, placenta 2. Stomach - Northern Blot, Annilo T et al, Cytogenetic and Genome Research, 2002: 169-76
Tissues:Lung, testis, placenta, stomach
Type:protein-coding
Sets:0
PharmGKB ID:PA24376
HPRD ID:07416
Substrates:None
Trivial Names:LI2, ICR2B, ARCI4A, ARCI4B
Transcripts:NM_015657.3 [Chr.2(-): 215796266-215896810 GRCh37]
NM_173076.2 [Chr.2(-): 215796266-216003151 GRCh37]
ENST00000272895 [Chr.2(-): 215796266-216003151 GRCh37]
ENST00000389661 [Chr.2(-): 215797346-215896810 GRCh37]
ENST00000412081 [Chr.2(-): 215940215-216003127 GRCh37]
Annotation History:View Events (3)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for ABCA12.

Variant Data

View all PMT variants for ABCA12 on UCSC Genome Browser
Showing SNP features for transcript:   
ABCA12 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:ABCA12 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
216003640 GRCh37
215711885 NCBI36
-489-709
TAGGGAAAGTGTCCACCTTTAACCT A → G AAGTTGAATGTTTCGATTTTGGGGG
+ 
 
n=
A/A=
A/G=
G/G=
G=
132
65
1
0
0.008
130
65
0
0
0.000
130
65
0
0
0.000
116
58
0
0
0.000
PMT-272
 PDEI
216003407 GRCh37
215711652 NCBI36
-256-476
GTCACAGGGACTAGGGGGTGGGACC T → C TTGCAAGGCCAGTAGGACTTGTCCT
+ 
 
n=
T/T=
T/C=
C/C=
C=
132
11
31
24
0.598
130
40
21
4
0.223
130
65
0
0
0.000
116
39
15
4
0.198
PMT-272
Promoter
216003393 GRCh37
215711638 NCBI36
-242-462
CCTGCACTGGATGCGTCACAGGGAC T → G AGGGGGTGGGACCTTTGCAAGGCCA
+ 
 
n=
T/T=
T/G=
G/G=
G=
132
66
0
0
0.000
130
65
0
0
0.000
130
65
0
0
0.000
116
57
1
0
0.009
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.