UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:ABCA13
HGNC Symbol:ABCA13
HGNC Description:ATP-binding cassette, sub-family A (ABC1), member 13
HGNC ID:14638
Superfamily:ABC
Chromosome:Chr.7(+): 48211057-48687091 GRCh37
Location:7p12.3
OMIM:607807
OMIM Phenotype:None
Accessions:AY204751
Nucleotide RefSeq:NM_152701
Protein RefSeq:NP_689914
Entrez:154664
Ensembl:ENSG00000179869
Isoforms:4
Evidence:Substrate In Vivo Evidence: 1. Largest ABC protein to date (5058 aa, 62 exons). 7p12.3 contains a locus associated with an inherited disorder affecting the pancreas and a locus involved in T-cell tumor invasion and metastasis. Prades, C et al. Cytogenet Genome Res 2002, 98(2-3):160-8 PMID 12697998. 2. Mouse Abca13 mRNA isolated from kidney. Analysis of promoter region revealed potential transcription factor binding sites associated with myeloid- and lymphoid-derived cell types. Gene 2003 Mar 27, 307:191-200 PMID 12706902. Tissue Distribution Evidence: 1. Highest expression in human trachea, testis, and bone marrow. High expression also detected in leukemia, CNS tumor, and prostate tumor cell lines. Prades, C et al. Cytogenet Genome Res 2002, 98(2-3):160-8 PMID 12697998. 2. RNA dot blots showed that mouse Abca13 mRNA transcript levels were highest in mouse submaxillary gland, epididymus, ovary, and thymus. Barros, SA; Tennant, RW; Cannon RE. Gene 2003 Mar 27, 307:191-200 PMID 12706902.
Tissues:trachae, testis, bone marrow (cell lines: leukemia, CNS tumor, prostate tumor)
Type:protein-coding
Sets:0
PharmGKB ID:PA134925234
HPRD ID:07422
Substrates:unknown
Trivial Names:
Transcripts:NM_152701.3 [Chr.7(+): 48211057-48687091 GRCh37]
XM_005249623.1 [Chr.7(+): 48317707-48687088 GRCh37]
XM_005249624.1 [Chr.7(+): 48317707-48687088 GRCh37]
XM_005249625.1 [Chr.7(+): 48317707-48666688 GRCh37]
ENST00000411975 [Chr.7(+): 48494660-48687092 GRCh37]
ENST00000417403 [Chr.7(+): 48211055-48312592 GRCh37]
ENST00000435451 [Chr.7(+): 48547468-48559741 GRCh37]
ENST00000435803 [Chr.7(+): 48211057-48687091 GRCh37]
ENST00000453246 [Chr.7(+): 48416039-48684314 GRCh37]
ENST00000484268 [Chr.7(+): 48352664-48444262 GRCh37]
ENST00000544596 [Chr.7(+): 48494660-48687092 GRCh37]
Annotation History:View Events (26)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for ABCA13.

Variant Data

View all PMT variants for ABCA13 on UCSC Genome Browser
Showing SNP features for transcript:   
ABCA13 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:ABCA13 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
48237634 GRCh37
48208189 NCBI36
  
TTCTGCCTTGAAACATGAGTACTGA C → T CCTGGAAGAAAGGTGTTAGATATAA
+ 
 
n=
C/C=
C/T=
T/T=
T=
132
66
0
0
0.000
136
67
1
0
0.007
130
65
0
0
0.000
128
64
0
0
0.000
PMT-272
 PDE
48237636 GRCh37
48208191 NCBI36
  
CTGCCTTGAAACATGAGTACTGACC C → T TGGAAGAAAGGTGTTAGATATAAAG
+ 
 
n=
C/C=
C/T=
T/T=
T=
132
65
1
0
0.008
136
68
0
0
0.000
130
65
0
0
0.000
128
64
0
0
0.000
PMT-272
 PDEI
48237721 GRCh37
48208276 NCBI36
  
CCCTTAGATCTCCTTTAAATTAATA G → C CAAGGTTAATAATATAATAATATGA
+ 
 
n=
G/G=
G/C=
C/C=
C=
132
39
25
2
0.220
136
50
15
3
0.154
130
31
31
3
0.285
128
42
17
5
0.211
PMT-272
 PDEI
48237802 GRCh37
48208357 NCBI36
  
AATTCCATTTCTGGTAGCAGGTATA T → C GGACTCATTTCTTCTTTGCATCTAT
+ 
 
n=
T/T=
T/C=
C/C=
C=
132
3
23
40
0.780
136
21
33
14
0.449
130
15
34
16
0.508
128
11
27
26
0.617
PMT-272
 
48237824 GRCh37
48208379 NCBI36
  
ATATGGACTCATTTCTTCTTTGCAT C → T TATTTCTAGGTTATTTGCAGCCCCG
+ 
 
n=
C/C=
C/T=
T/T=
T=
132
39
25
2
0.220
136
50
15
3
0.154
130
31
32
2
0.277
128
41
19
4
0.211
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.