UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:ABC2
HGNC Symbol:ABCA2
HGNC Description:ATP-binding cassette, sub-family A (ABC1), member 2
HGNC ID:32
Superfamily:ABC
Chromosome:Chr.9(-): 139901686-139923374 GRCh37
Location:9q34
OMIM:600047
OMIM Phenotype:None
Accessions:NM_001606
Nucleotide RefSeq:NM_001606
Protein RefSeq:NP_001597
Entrez:20
Ensembl:ENSG00000107331
Isoforms:2
Evidence:Substrate In Vitro Evidence: 1. Resistance to estramustine using HEK293 transfected cell line, Vulevic B et al, Cancer Research 2001: 3339-3347 Tissue Distribution Evidence: 1. Brain 2. Low in Liver and Kidney Northern blot: Vulevic B et al, Cancer Research 2001: 3339-3347 1. Oligodendrocytes in adult rat spinal cord IHC and Western blot: Zhou CJ et al, Journal of Comparative Neurology 2002: 334-345
Tissues:brain, liver, kidney, oligodendrocytes
Type:protein-coding
Sets:V
PharmGKB ID:PA24377
HPRD ID:08967
Substrates:estramustine
Trivial Names:ABC2
Transcripts:NM_001606.4 [Chr.9(-): 139901686-139922740 GRCh37]
NM_212533.2 [Chr.9(-): 139901686-139923374 GRCh37]
ENST00000265662 [Chr.9(-): 139901686-139922740 GRCh37]
ENST00000341511 [Chr.9(-): 139901686-139922642 GRCh37]
ENST00000371605 [Chr.9(-): 139901686-139922740 GRCh37]
ENST00000398207 [Chr.9(-): 139916233-139923325 GRCh37]
ENST00000425423 [Chr.9(-): 139918265-139923259 GRCh37]
ENST00000431584 [Chr.9(-): 139905929-139907401 GRCh37]
ENST00000437791 [Chr.9(-): 139903859-139904836 GRCh37]
ENST00000448336 [Chr.9(-): 139902385-139903922 GRCh37]
ENST00000459850 [Chr.9(-): 139901829-139923367 GRCh37]
ENST00000463603 [Chr.9(-): 139903803-139905468 GRCh37]
ENST00000464157 [Chr.9(-): 139902688-139903240 GRCh37]
ENST00000464520 [Chr.9(-): 139902109-139903635 GRCh37]
ENST00000464876 [Chr.9(-): 139913878-139922630 GRCh37]
ENST00000466707 [Chr.9(-): 139912014-139912670 GRCh37]
ENST00000467624 [Chr.9(-): 139913407-139913815 GRCh37]
ENST00000470535 [Chr.9(-): 139913235-139915257 GRCh37]
ENST00000476211 [Chr.9(-): 139916119-139923329 GRCh37]
ENST00000479446 [Chr.9(-): 139901694-139912671 GRCh37]
ENST00000487109 [Chr.9(-): 139901829-139923367 GRCh37]
ENST00000488535 [Chr.9(-): 139906777-139912663 GRCh37]
ENST00000490486 [Chr.9(-): 139902303-139904030 GRCh37]
ENST00000492260 [Chr.9(-): 139912664-139922623 GRCh37]
ENST00000494046 [Chr.9(-): 139914635-139922636 GRCh37]
Annotation History:View Events (3)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for ABCA2.

Variant Data

View all PMT variants for ABCA2 on UCSC Genome Browser
Showing SNP features for transcript:   
ABCA2 RESEQUENCING  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:ABCA2 RESEQUENCING
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
139902445 GRCh37
139022266 NCBI36
  
TGCACAGGGGAGGTCAGGCTTATGG G → C GCATCCTGTGCCACCCCCTGCTGGG
+ 
 
n=
G/G=
G/C=
C/C=
C=
130
65
0
0
0.000
134
67
0
0
0.000
136
68
0
0
0.000
134
66
1
0
0.007
PMT-272
Exon 49: CodingPDE
139902389 GRCh37
139022210 NCBI36
74517303
GGCCCAGCTCTGGGTGGTCAGCAGA G → A CGTGTCCGTGTTGAAGGACAGCTGG
+2435
Leu → Phe
(D=22)
n=
G/G=
G/A=
A/A=
A=
130
65
0
0
0.000
134
67
0
0
0.000
136
68
0
0
0.000
134
66
1
0
0.007
PMT-272
Exon 49: 3UTRPDE
139902247 GRCh37
139022068 NCBI36
7593 
TGGCCGAGTACAGGGGCTGGAGGAC C → T AGAAGCCCCTTGGTCCTGAACCTCC
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
65
0
0
0.000
134
67
0
0
0.000
136
67
1
0
0.007
134
67
0
0
0.000
PMT-272
Exon 49: 3UTRPDE
139902214 GRCh37
139022035 NCBI36
7626 
ATTAGGGGCGGCAACCGCAGTGACC A → G CAGGGCATGGCCGAGTACAGGGGCT
+ 
 
n=
A/A=
A/G=
G/G=
G=
130
3
18
44
0.815
134
0
8
59
0.940
136
0
0
68
1.000
134
0
5
62
0.963
PMT-272
Exon 49: 3UTRPDE
139902166 GRCh37
139021987 NCBI36
7674 
AGCAGGGCAAGGGTGTACGCAGCCC G → A GGCCGGGTCAGCCTTTGGCACAATT
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
35
24
6
0.277
134
44
20
3
0.194
136
46
19
3
0.184
134
19
39
9
0.425
PMT-272
Exon 49: 3UTRPDE
139902087 GRCh37
139021908 NCBI36
7753 
TCCAGCCGGCGTCGCCTTGGGCGGT G → A AGCAGTGCCAGGCAGGGGCGAGGGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
64
1
0
0.008
134
67
0
0
0.000
136
67
1
0
0.007
134
67
0
0
0.000
PMT-272
Exon 49: 3UTRPDE
139901990 GRCh37
139021811 NCBI36
7850 
CCAGCTCCGCCCACAGCCCGCTCTC G → A GCATCAGCCTTCATCGTAAGAGAGA
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
66
0
0
0.000
136
64
4
0
0.029
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 49: 3UTRPDEI
139901981 GRCh37
139021802 NCBI36
7859 
GGGACTGACCCAGCTCCGCCCACAG C → A CCGCTCTCGGCATCAGCCTTCATCG
+ 
 
n=
C/C=
C/A=
A/A=
A=
132
65
1
0
0.008
136
63
5
0
0.037
136
68
0
0
0.000
136
67
1
0
0.007
PMT-272
Exon 49: 3UTRPDEI
139901891 GRCh37
139021712 NCBI36
7949 
CTGGCCCAAGCTGATGGCTTCCCGC A → G GGACAGCCACCTCCCTGCAGGAGAG
+ 
 
n=
A/A=
A/G=
G/G=
G=
132
3
18
45
0.818
136
0
8
60
0.941
136
0
0
68
1.000
136
0
5
63
0.963
PMT-272
Exon 49: 3UTRPDE
139901890 GRCh37
139021711 NCBI36
7950 
GCTGGCCCAAGCTGATGGCTTCCCG C → A AGGACAGCCACCTCCCTGCAGGAGA
+ 
 
n=
C/C=
C/A=
A/A=
A=
132
66
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 49: 3UTRPDE
139901816 GRCh37
139021637 NCBI36
8024 
CAGCTGGGGGTTGGGGGGGGTCTGG C → T CCCTTGCCTGGCCAGCAGGGTCAGC
+ 
 
n=
C/C=
C/T=
T/T=
T=
132
66
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
 PDE
139901534 GRCh37
139021355 NCBI36
  
TGGGATGAGGGGGACAGTGAACCAT G → A GTGAACCACCCTGCCTCAGTTTCCC
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
66
0
0
0.000
136
65
3
0
0.022
136
68
0
0
0.000
136
67
1
0
0.007
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.