UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:ABC3
HGNC Symbol:ABCA3
HGNC Description:ATP-binding cassette, sub-family A (ABC1), member 3
HGNC ID:33
Superfamily:ABC
Chromosome:Chr.16(-): 2325879-2390747 GRCh37
Location:16p13.3
OMIM:601615
OMIM Phenotype:Surfactant deficiency, neonatal
Accessions:U78735
Nucleotide RefSeq:NM_001089
Protein RefSeq:NP_001080
Entrez:21
Ensembl:ENSG00000167972
Isoforms:3
Evidence:Substrate In Vitro Evidence: 1. May play a role in lipid transport/organization during the formation of lamellar bodies (specialized secretory organelles of alveolar epithelial cells through which the packaging and secretion of pulmonary surfactant are regulated). MS of product from IP with LBM180 (see "trivial names") antibody resulted in partial sequence of ABCA3. Mulugeta, S. et al. JBC 2002 Jun 21, 277(25):22147-55 PMID 11940594. Tissue Distribution Evidence: 1. Gene transcript found in human lung cell lines and alveolar epithelial (ATII) cells (developmentally regulated). Mulugeta, S. et al. JBC 2002 Jun 21, 277(25):22147-55 PMID 11940594. 2. Highest levels in lung, lesser amounts in brain, heart, and pancreas (Northern blot). Connors, TD et al. Genomics 1997, 39:231-4. 3. RT-PCR detected high levels of ABCA3 in leukemic progenitor cells. Norwood, K et al. 2004 Mar, 28(3):295-9 PMID 14687625.
Tissues:lung (high), brain, heart, pancreas
Type:protein-coding
Sets:0
PharmGKB ID:PA24378
HPRD ID:03369
Substrates:unknown
Trivial Names:ABC3, ABC-C, SMDP3, LBM180, EST111653
Transcripts:NM_001089.2 [Chr.16(-): 2325879-2390747 GRCh37]
XM_005255168.1 [Chr.16(-): 2325881-2390736 GRCh37]
XM_005255169.1 [Chr.16(-): 2325881-2357829 GRCh37]
ENST00000301732 [Chr.16(-): 2325882-2390736 GRCh37]
ENST00000382381 [Chr.16(-): 2325882-2390747 GRCh37]
ENST00000563623 [Chr.16(-): 2339049-2390598 GRCh37]
ENST00000566200 [Chr.16(-): 2328296-2333742 GRCh37]
ENST00000567910 [Chr.16(-): 2373340-2379725 GRCh37]
ENST00000569062 [Chr.16(-): 2331394-2333973 GRCh37]
Annotation History:View Events (19)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for ABCA3.

Variant Data

View all PMT variants for ABCA3 on UCSC Genome Browser
Showing SNP features for transcript:   
ABCA3 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:ABCA3 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
2391308 GRCh37
2331309 NCBI36
-561-14841
CGTCGAGTTTACAGGAGAAGGCGCG G → C TGTCCCGGGATGAGCGGAGTCGCCC
+ 
 
n=
G/G=
G/C=
C/C=
C=
126
62
1
0
0.008
126
63
0
0
0.000
128
64
0
0
0.000
124
62
0
0
0.000
PMT-272
 
2391057 GRCh37
2331058 NCBI36
-310-14590
GCCGAGCGAGGGCGCGGTGGCCTCT G → C ACAGGAATGACTCTGCGCACGTGCG
+ 
 
n=
G/G=
G/C=
C/C=
C=
130
65
0
0
0.000
130
61
4
0
0.031
134
67
0
0
0.000
128
64
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.