UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:ABC10
HGNC Symbol:ABCA4
HGNC Description:ATP-binding cassette, sub-family A (ABC1), member 4
HGNC ID:34
Superfamily:ABC
Chromosome:Chr.1(-): 94458393-94586705 GRCh37
Location:1p22
OMIM:601691
OMIM Phenotype:Startgardt disease 1; Macular degeneratons, age-related, 2; Retinitis pigmentosa 19; Cone-rod dystrophy 3; Fundus flavimaculatus
Accessions:AF000148,U88667
Nucleotide RefSeq:NM_000350
Protein RefSeq:NP_000341
Entrez:24
Ensembl:ENSG00000198691
Isoforms:1
Evidence:Substrate In Vitro Evidence: 1. all-trans-retinal aldehyde - stimulation of ATPase activity of bovine ABCR - Sun H et al, JBC 1999: 8269-8281 Substrate In Vivo Evidence: 1. Stargardt Disease - Yatsenko AN et al, Human Mutation 2003: 636-644 2. Recessive Cone-Rod Dystrophy - Maugeri A et al, American Journal of Human Genetics 2000: 960-966 Tissue Distribution Evidence: Photoreceptors - IHC and Western Blot - Molday LL et al, Nature Genetics 2000: 257-8
Tissues:photoreceptors
Type:protein-coding
Sets:0
PharmGKB ID:PA24379
HPRD ID:03408
Substrates:all-trans-retinal aldehyde
Trivial Names:FFM, RMP, ABCR, RP19, STGD, ABC10, ARMD2, CORD3, STGD1
Transcripts:NM_000350.2 [Chr.1(-): 94458393-94586705 GRCh37]
ENST00000370225 [Chr.1(-): 94458393-94586688 GRCh37]
ENST00000460514 [Chr.1(-): 94485138-94491151 GRCh37]
ENST00000465352 [Chr.1(-): 94467064-94476485 GRCh37]
ENST00000470771 [Chr.1(-): 94484956-94486923 GRCh37]
ENST00000472033 [Chr.1(-): 94525025-94526995 GRCh37]
ENST00000484388 [Chr.1(-): 94470931-94473308 GRCh37]
ENST00000535735 [Chr.1(-): 94511193-94586681 GRCh37]
ENST00000535881 [Chr.1(-): 94458738-94477181 GRCh37]
ENST00000536513 [Chr.1(-): 94458738-94484228 GRCh37]
Annotation History:View Events (2)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for ABCA4.

Variant Data

View all PMT variants for ABCA4 on UCSC Genome Browser
Showing SNP features for transcript: NM_000350  
ABCA4 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:ABCA4 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDEI
94587114 GRCh37
94359702 NCBI36
-409-513
GTGATCCCTCCCTCTTTTAGTCTTT C → T ATCTTGCTCCGTAATGACTGAAGTC
+ 
 
n=
C/C=
C/T=
T/T=
T=
132
42
23
1
0.189
136
68
0
0
0.000
130
64
1
0
0.008
132
63
3
0
0.023
PMT-272
PromoterPDE
94586939 GRCh37
94359527 NCBI36
-234-338
ATGAGAGGGGTTCCTGAGGGGGATG T → A CTTTAGGTATCTTTGACCTTAAGTT
+ 
 
n=
T/T=
T/A=
A/A=
A=
132
66
0
0
0.000
136
68
0
0
0.000
130
65
0
0
0.000
132
65
1
0
0.008
PMT-272
PromoterPDEI
94586890 GRCh37
94359478 NCBI36
-185-289
TGAGGTGGGGGATGCAATGGGAAAC C → A AAGACCCTCAGGCACTCTCCTCCAT
+ 
 
n=
C/C=
C/A=
A/A=
A=
132
52
13
1
0.114
136
68
0
0
0.000
130
65
0
0
0.000
132
66
0
0
0.000
PMT-272
PromoterPDEI
94586844 GRCh37
94359432 NCBI36
-139-243
GAGAAAGAGAACCCTAAAGACACAA G → A TGGCTGGGCACCAGGGAAATTGAGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
52
13
1
0.114
136
68
0
0
0.000
130
65
0
0
0.000
132
66
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.