UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:ABC13
HGNC Symbol:ABCA5
HGNC Description:ATP-binding cassette, sub-family A (ABC1), member 5
HGNC ID:35
Superfamily:ABC
Chromosome:Chr.17(-): 67240576-67323323 GRCh37
Location:17q24.3
OMIM:612503
OMIM Phenotype:None
Accessions:AB067475,AK096664,AY028897
Nucleotide RefSeq:NM_172232
Protein RefSeq:NP_758424
Entrez:23461
Ensembl:ENSG00000154265
Isoforms:4
Evidence:Tissue Distribution Evidence: 1. Northern blot studies showed expression in skeletal muscle and at lower levels in kidney, liver, and placenta. Also detected in Caco-2 cells. Rat Abca5 mRNA expression is upregulated during culture of primary rat hepatocytes. Petry, F; Kotthaus, A; Hirsch-Ernst, KI. Biochem Biophys Res Comm 2003 Jan 10, 300(2):343-50 PMID 12504089.
Tissues:skeletal muscle, kidney, liver, placenta
Type:protein-coding
Sets:0
PharmGKB ID:PA24380
HPRD ID:09789
Substrates:unknown
Trivial Names:ABC13, EST90625
Transcripts:NM_018672.3 [Chr.17(-): 67240576-67311774 GRCh37]
NM_172232.2 [Chr.17(-): 67240576-67323323 GRCh37]
XM_005257177.1 [Chr.17(-): 67242930-67323323 GRCh37]
XM_005257178.1 [Chr.17(-): 67246684-67323323 GRCh37]
ENST00000392676 [Chr.17(-): 67240452-67323242 GRCh37]
ENST00000392677 [Chr.17(-): 67240576-67323323 GRCh37]
ENST00000586601 [Chr.17(-): 67243517-67245282 GRCh37]
ENST00000586811 [Chr.17(-): 67244401-67265015 GRCh37]
ENST00000586995 [Chr.17(-): 67243487-67298990 GRCh37]
ENST00000587607 [Chr.17(-): 67302904-67323231 GRCh37]
ENST00000588106 [Chr.17(-): 67245429-67247769 GRCh37]
ENST00000588665 [Chr.17(-): 67309426-67323385 GRCh37]
ENST00000588877 [Chr.17(-): 67243092-67311566 GRCh37]
ENST00000589609 [Chr.17(-): 67313041-67323252 GRCh37]
ENST00000589975 [Chr.17(-): 67300235-67305461 GRCh37]
ENST00000591234 [Chr.17(-): 67243286-67282402 GRCh37]
ENST00000592568 [Chr.17(-): 67305490-67323238 GRCh37]
ENST00000593153 [Chr.17(-): 67270112-67323323 GRCh37]
ENST00000593253 [Chr.17(-): 67302904-67311501 GRCh37]
Annotation History:View Events (18)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for ABCA5.

Variant Data

View all PMT variants for ABCA5 on UCSC Genome Browser
Showing SNP features for transcript:   
ABCA5 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:ABCA5 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
67323610 GRCh37
64835205 NCBI36
-287-13054
TCTCGCCACGCTCTTTCTGGAGGCA C → G GGGCAAAAACCACGGCCTCGTGTCT
+ 
 
n=
C/C=
C/G=
G/G=
G=
132
54
12
0
0.091
128
45
16
3
0.172
130
65
0
0
0.000
134
61
6
0
0.045
PMT-272
PromoterPDE
67323468 GRCh37
64835063 NCBI36
-145-12912
GCAGGCAAGCAGCGCGCCCGGAAGA G → A GAGAGCGGCTGAGGGTGGGGCGAGC
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
65
1
0
0.008
130
65
0
0
0.000
130
65
0
0
0.000
136
66
2
0
0.015
PMT-272
PromoterPDE
67323438 GRCh37
64835033 NCBI36
-115-12882
AGACGCTCGGCCCCGCGCGTCCCGG C → G GCACGCAGGCAAGCAGCGCGCCCGG
+ 
 
n=
C/C=
C/G=
G/G=
G=
132
66
0
0
0.000
130
64
1
0
0.008
130
65
0
0
0.000
136
68
0
0
0.000
PMT-272
PromoterPDE
67323415 GRCh37
64835010 NCBI36
-92-12859
CGCTCCGCGTACGGGCGCGCTTCAG A → T CGCTCGGCCCCGCGCGTCCCGGCGC
+ 
 
n=
A/A=
A/T=
T/T=
T=
132
66
0
0
0.000
130
65
0
0
0.000
130
64
1
0
0.008
136
68
0
0
0.000
PMT-272
PromoterPDE
67323368 GRCh37
64834963 NCBI36
-45-12812
CCCGCCTCCTGCAGAGCGCACCTGA G → A GGCGGGGCTCCTAGAAAGCGCCGCT
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
65
1
0
0.008
130
65
0
0
0.000
130
65
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 1: 5UTR
Promoter
PDE
67323286 GRCh37
64834881 NCBI36
38-12730
CAGCTGGGATCTGTGCGAGGGCGCG G → GCCGCGCGCAC CCGCGCGCACCCGCGCGCTCCTGGC
+ 
 
n=
G/G=
G/GCCGCGCGCAC=
GCCGCGCGCAC/GCCGCGCGCAC=
GCCGCGCGCAC=
130
49
16
0
0.123
130
48
17
0
0.131
130
56
9
0
0.069
136
53
15
0
0.110
PMT-272
Exon 1: 5UTRPDE
67323199 GRCh37
64834794 NCBI36
125-12643
CCCGCGACGCCCGCCTCACCTCAGG G → C CCCGAGCCGCAGAGCTGTCAGGCCT
+ 
 
n=
G/G=
G/C=
C/C=
C=
98
48
1
0
0.010
98
49
0
0
0.000
112
56
0
0
0.000
108
54
0
0
0.000
PMT-272
 PDE
67323155 GRCh37
64834750 NCBI36
 -12599
CCCCAGGGACGGCTGTCCCAGGCTA G → A CCTCAAGCGCCGCCGCCGCCCGCGA
+ 
 
n=
G/G=
G/A=
A/A=
A=
98
34
14
1
0.163
98
46
3
0
0.031
112
56
0
0
0.000
108
50
4
0
0.037
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.