UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:ABCA6
HGNC Symbol:ABCA6
HGNC Description:ATP-binding cassette, sub-family A (ABC1), member 6
HGNC ID:36
Superfamily:ABC
Chromosome:Chr.17(-): 67074847-67138015 GRCh37
Location:17q24.3
OMIM:612504
OMIM Phenotype:None
Accessions:AY028898
Nucleotide RefSeq:NM_080284
Protein RefSeq:NP_525023
Entrez:23460
Ensembl:ENSG00000154262
Isoforms:1
Evidence:Substrate In Vivo Evidence: 1. Based on structural features and cholesterol-responsive regulation, this protein is potentially involved in macrophage lipid homeostasis. Kaminski, WE et al. Biochem Biophys Res Comm 2001 Aug 3, 285(5):1295-01 PMID 11478798 Tissue Distribution Evidence: 1. Cloned from human macrophages. Ubiquitously expressed with highest levels in liver, lung, heart, brain, and ovaries (mRNA dot blot). Kaminski, WE et al. Biochem Biophys Res Comm 2001 Aug 3, 285(5):1295-01 PMID 11478798.
Tissues:liver, lung, heart, brain, ovaries, ubiquitous
Type:protein-coding
Sets:0
PharmGKB ID:PA24381
HPRD ID:10622
Substrates:unknown
Trivial Names:EST155051
Transcripts:NM_080284.2 [Chr.17(-): 67074847-67138015 GRCh37]
ENST00000284425 [Chr.17(-): 67074843-67138015 GRCh37]
ENST00000446604 [Chr.17(-): 67075058-67094733 GRCh37]
ENST00000589482 [Chr.17(-): 67081795-67083759 GRCh37]
ENST00000589803 [Chr.17(-): 67101632-67114129 GRCh37]
ENST00000590311 [Chr.17(-): 67100053-67111583 GRCh37]
ENST00000590645 [Chr.17(-): 67131371-67138029 GRCh37]
ENST00000592493 [Chr.17(-): 67110921-67112055 GRCh37]
Annotation History:View Events (2)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for ABCA6.

Variant Data

View all PMT variants for ABCA6 on UCSC Genome Browser
Showing SNP features for transcript: NM_080284  
ABCA6 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:ABCA6 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
67138470 GRCh37
64650065 NCBI36
-455-1626
ATAAAGCTAAGCAATCCATAGTACG C → T CTTGGAGAAACTCCTAGGACAGACA
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
57
11
0
0.081
136
68
0
0
0.000
134
67
0
0
0.000
134
66
1
0
0.007
PMT-272
PromoterPDE
67138198 GRCh37
64649793 NCBI36
-183-1354
GTTCACTTAGCCTTTCAACTACAGG G → A ATAAGGGGGAAAACGGTAAACAAGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
68
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
134
66
1
0
0.007
PMT-272
PromoterPDEI
67138138 GRCh37
64649733 NCBI36
-123-1294
TTATTCTGCAAGGAAATGACTGTTC C → T GTGGTTGGTTGGGAATAAAATAAAC
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
28
31
9
0.360
136
12
25
31
0.640
134
26
26
15
0.418
134
4
32
31
0.701
PMT-272
PromoterPDE
67138132 GRCh37
64649727 NCBI36
-117-1288
AGCCAATTATTCTGCAAGGAAATGA C → T TGTTCCGTGGTTGGTTGGGAATAAA
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
67
1
0
0.007
136
68
0
0
0.000
134
67
0
0
0.000
134
67
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.