UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:ABCX
HGNC Symbol:ABCA7
HGNC Description:ATP-binding cassette, sub-family A (ABC1), member 7
HGNC ID:37
Superfamily:ABC
Chromosome:Chr.19(+): 1040102-1065571 GRCh37
Location:19p13.3
OMIM:605414
OMIM Phenotype:None
Accessions:AF250238,AF328787
Nucleotide RefSeq:NM_019112
Protein RefSeq:NP_061985
Entrez:10347
Ensembl:ENSG00000064687
Isoforms:1
Evidence:Substrate In Vitro Evidence: 1. Phospholipids - HEK293 transport assay - Wang N et al, JBC 2003: 42906-429-12 Tissue Distribution Evidence: 1. Thymus, spleen, lymph node, bone marrow, peripheral leukocytes, fetal liver - Northern Blot - Kaminski WE et al, Biochemical and Biophysical Research Communications 2000: 532-538
Tissues:thymus, spleen, lymph node, bone marrow, peripheral leukocytes, fetal liver
Type:protein-coding
Sets:0
PharmGKB ID:PA24382
HPRD ID:09255
Substrates:phospholipids
Trivial Names:ABCX, ABCA-SSN
Transcripts:NM_019112.3 [Chr.19(+): 1040102-1065571 GRCh37]
ENST00000263094 [Chr.19(+): 1040102-1065568 GRCh37]
ENST00000433129 [Chr.19(+): 1041361-1065568 GRCh37]
ENST00000435683 [Chr.19(+): 1042661-1065424 GRCh37]
ENST00000524383 [Chr.19(+): 1064658-1065327 GRCh37]
ENST00000524850 [Chr.19(+): 1040119-1042390 GRCh37]
ENST00000525073 [Chr.19(+): 1056933-1065568 GRCh37]
ENST00000525238 [Chr.19(+): 1040126-1042464 GRCh37]
ENST00000525939 [Chr.19(+): 1062260-1063944 GRCh37]
ENST00000526885 [Chr.19(+): 1040122-1042743 GRCh37]
ENST00000527496 [Chr.19(+): 1041204-1042103 GRCh37]
ENST00000529442 [Chr.19(+): 1057039-1058156 GRCh37]
ENST00000530092 [Chr.19(+): 1054077-1055938 GRCh37]
ENST00000530703 [Chr.19(+): 1040115-1041681 GRCh37]
ENST00000531467 [Chr.19(+): 1041201-1042175 GRCh37]
ENST00000531478 [Chr.19(+): 1064051-1065571 GRCh37]
ENST00000532194 [Chr.19(+): 1057039-1059262 GRCh37]
ENST00000533574 [Chr.19(+): 1045531-1047553 GRCh37]
Annotation History:View Events (2)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for ABCA7.

Variant Data

View all PMT variants for ABCA7 on UCSC Genome Browser
Showing SNP features for transcript: NM_019112  
ABCA7 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:ABCA7 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
1040744 GRCh37
991744 NCBI36
 -617
CGATTAATGCTACATAAGGTGTGGG C → G AGAGCTGGGGTCGTGCCTCCGGCTG
+ 
 
n=
C/C=
C/G=
G/G=
G=
126
55
7
1
0.071
124
62
0
0
0.000
132
66
0
0
0.000
128
64
0
0
0.000
PMT-272
 PDE
1040765 GRCh37
991765 NCBI36
 -596
TGGGCAGAGCTGGGGTCGTGCCTCC G → A GCTGGGCAACTGCCTGTCTCTCTGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
128
7
23
34
0.711
126
15
27
21
0.548
132
10
33
23
0.598
130
31
29
5
0.300
PMT-272
 PDE
1040772 GRCh37
991772 NCBI36
 -589
AGCTGGGGTCGTGCCTCCGGCTGGG C → G AACTGCCTGTCTCTCTGGGTGCCTG
+ 
 
n=
C/C=
C/G=
G/G=
G=
128
61
3
0
0.023
132
66
0
0
0.000
134
67
0
0
0.000
130
65
0
0
0.000
PMT-272
 PDE
1040773 GRCh37
991773 NCBI36
 -588
GCTGGGGTCGTGCCTCCGGCTGGGC A → G ACTGCCTGTCTCTCTGGGTGCCTGG
+ 
 
n=
A/A=
A/G=
G/G=
G=
128
35
25
4
0.258
132
60
6
0
0.045
134
54
12
1
0.104
130
64
1
0
0.008
PMT-272
 PDE
1040969 GRCh37
991969 NCBI36
 -392
GGCTGGGCCAGGCAGGAGGCTGGGG G → - TCAGGACCTGGAAGAGGCTTCCAGG
+ 
 
n=
G/G=
G/-=
-/-=
-=
130
54
10
1
0.092
132
66
0
0
0.000
134
67
0
0
0.000
130
65
0
0
0.000
PMT-272
 PDE
1041086 GRCh37
992086 NCBI36
 -275
GATGATCTTTAAGTCCCCAGCTGTC A → G GCCCTGCTCAGAGCGACAGTCCTGG
+ 
 
n=
A/A=
A/G=
G/G=
G=
110
39
15
1
0.155
132
66
0
0
0.000
134
67
0
0
0.000
130
64
1
0
0.008
PMT-272
 PDE1 pubI
1041164 GRCh37
992164 NCBI36
 -197
GGGTTGCGCTCCCATTGGTTTACTC C → T ACCCCTGGGGTAGCGGAGCCTCTTT
+ 
 
n=
C/C=
C/T=
T/T=
T=
110
51
3
1
0.045
132
60
6
0
0.045
134
54
12
1
0.104
130
65
0
0
0.000
PMT-272
 PDE
1041213 GRCh37
992213 NCBI36
 -148
TTATCGAGTGACTACTGTTTGCCTC G → C CTCTAATCAGAGCTTCCAGGAACCC
+ 
 
n=
G/G=
G/C=
C/C=
C=
110
55
0
0
0.000
132
65
1
0
0.008
134
67
0
0
0.000
130
65
0
0
0.000
PMT-272
Exon 2: 5UTRPDE
1041286 GRCh37
992286 NCBI36
157-75
AGGTTCAGAAAGGGGCAGGGAGTTG C → T CCGCAGCCGCACCGCACGTCTTCAG
+ 
 
n=
C/C=
C/T=
T/T=
T=
110
54
1
0
0.009
132
66
0
0
0.000
134
67
0
0
0.000
130
65
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.