UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:ABCA8
HGNC Symbol:ABCA8
HGNC Description:ATP-binding cassette, sub-family A (ABC1), member 8
HGNC ID:38
Superfamily:ABC
Chromosome:Chr.17(-): 66863428-66951550 GRCh37
Location:17q24
OMIM:612505
OMIM Phenotype:None
Accessions:NM_007168
Nucleotide RefSeq:NM_007168
Protein RefSeq:NP_009099
Entrez:10351
Ensembl:ENSG00000141338
Isoforms:5
Evidence:Substrate In Vitro Evidence: Xenopus laevis oocytes. Tsuruoka S, et al. Biochem Biophys Res Commun. 2002; 298: 41-5. Estradiol-(-glucuronide KM = 30.4 uM LTC4 KM = 0.1 uM Taurocholate KM = 10.3 uM MS-209 Inhibited estradiol-(-glucuronide uptake MK-571 Inhibited estradiol-(-glucuronide uptake Ochratoxin A Inhibited estradiol-(-glucuronide uptake Tissue Distribution Evidence: Testis, Trachea >>> Uterus, Prostate 1. TaqMan RT-PCR. Langmann T, et al. Clinical Chemistry. 2003; 49: 230-8. Heart >> Skeletal muscle, liver 1. Northern Blot. Tsuruoka S, et al. Biochem Biophys Res Commun. 2002; 298: 41-5.
Tissues:Heart, Skeletal muscle, Testis, Trachea, Liver, Uterus, Prostate
Type:protein-coding
Sets:V
PharmGKB ID:PA24383
HPRD ID:09790
Substrates:Estradiol-b-glucuronide, LTC4, Taurocholate, MS-209, MK571, Ochratoxin A
Trivial Names:
Transcripts:NM_007168.2 [Chr.17(-): 66863430-66951533 GRCh37]
XM_005256940.1 [Chr.17(-): 66863428-66951550 GRCh37]
XM_005256938.1 [Chr.17(-): 66863428-66951525 GRCh37]
XM_005256939.1 [Chr.17(-): 66863428-66951491 GRCh37]
XM_005256941.1 [Chr.17(-): 66880544-66951525 GRCh37]
ENST00000269080 [Chr.17(-): 66863433-66951492 GRCh37]
ENST00000428549 [Chr.17(-): 66927903-66951492 GRCh37]
ENST00000430352 [Chr.17(-): 66864193-66938225 GRCh37]
ENST00000541225 [Chr.17(-): 66882941-66951466 GRCh37]
ENST00000585531 [Chr.17(-): 66933212-66941015 GRCh37]
ENST00000585850 [Chr.17(-): 66927903-66951533 GRCh37]
ENST00000586292 [Chr.17(-): 66872821-66880738 GRCh37]
ENST00000586539 [Chr.17(-): 66864193-66951382 GRCh37]
ENST00000587206 [Chr.17(-): 66914219-66916138 GRCh37]
ENST00000588458 [Chr.17(-): 66872455-66873787 GRCh37]
ENST00000589533 [Chr.17(-): 66890186-66925256 GRCh37]
ENST00000589980 [Chr.17(-): 66876920-66878746 GRCh37]
ENST00000590359 [Chr.17(-): 66890925-66899568 GRCh37]
ENST00000591459 [Chr.17(-): 66873338-66876408 GRCh37]
Annotation History:View Events (38)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for ABCA8.

Variant Data

View all PMT variants for ABCA8 on UCSC Genome Browser
Showing SNP features for transcript:   
ABCA8 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:ABCA8 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
66952003 GRCh37
64463598 NCBI36
-470-13828
ACAAATTTGACATACAAAATATTTT T → C TCTGAGTATAATTGAACTCCTGATT
- 
 
n=
T/T=
T/C=
C/C=
C=
136
68
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
134
67
0
0
0.000
PMT-272
 PDE
66951984 GRCh37
64463579 NCBI36
-451-13809
TATTTTTTCTGAGTATAATTGAACT C → T CTGATTTAAAATTAAATCAATAACC
- 
 
n=
C/C=
C/T=
T/T=
T=
136
18
39
11
0.449
136
16
33
19
0.522
136
37
22
9
0.294
134
22
36
9
0.403
PMT-272
PromoterPDE
66951683 GRCh37
64463278 NCBI36
-150-13508
GCCACAATAATCTTGGACGTAAAAG A → G GAAATTGCTCCCTATAATATGATAT
- 
 
n=
A/A=
A/G=
G/G=
G=
136
66
2
0
0.015
136
68
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
Exon 38: CodingPDE
66864240 GRCh37
64375835 NCBI36
49114732
AATTTGGGGTTTTAAGGCTCTTCCT G → A GGGGAGGAGCTTCCACTTCACTGAG
+1578
Gln → STOP
n=
G/G=
G/A=
A/A=
A=
130
65
0
0
0.000
136
68
0
0
0.000
128
64
0
0
0.000
124
61
1
0
0.008
PMT-272
Exon 38: 3UTRPDE
66864191 GRCh37
64375786 NCBI36
4960 
TAAAAATAAATGTATTTAAAAAAAA C → A CACGGGTTTAAACAGGAACACAGAA
+ 
 
n=
C/C=
C/A=
A/A=
A=
130
63
2
0
0.015
136
68
0
0
0.000
128
64
0
0
0.000
124
62
0
0
0.000
PMT-272
Exon 38: 3UTRPDE
66864183 GRCh37
64375778 NCBI36
4968 
TGCTGCTATAAAAATAAATGTATTT A → T AAAAAAACCACGGGTTTAAACAGGA
+ 
 
n=
A/A=
A/T=
T/T=
T=
130
65
0
0
0.000
136
68
0
0
0.000
128
63
1
0
0.008
124
62
0
0
0.000
PMT-272
Exon 38: 3UTRPDE
66863931 GRCh37
64375526 NCBI36
5220 
ATTTAAACAAAATTTGTTTATCTTA T → - CTAGAAACTTATACGATCATGTAAA
+ 
 
n=
T/T=
T/-=
-/-=
-=
134
66
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 38: 3UTRPDE
66863915 GRCh37
64375510 NCBI36
5236 
GATTTTTATTAAAAAAATTTAAACA A → G AATTTGTTTATCTTATCTAGAAACT
+ 
 
n=
A/A=
A/G=
G/G=
G=
134
66
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
136
64
4
0
0.029
PMT-272
Exon 38: 3UTR
66863561 GRCh37
64375156 NCBI36
5590 
AAAAGATCATTTACAATGTAGACAT C → A ACTAAAGTCTAGATTTAAAAGTCCA
+ 
 
n=
C/C=
C/A=
A/A=
A=
136
68
0
0
0.000
134
67
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
PMT-272
Exon 38: 3UTR
66863511 GRCh37
64375106 NCBI36
5640 
AGCTGTTGCTACATTTGTGAACTTT C → T TGAAACCAAGTGACAAATATCCACA
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
68
0
0
0.000
134
66
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.