UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:ABCA9
HGNC Symbol:ABCA9
HGNC Description:ATP-binding cassette, sub-family A (ABC1), member 9
HGNC ID:39
Superfamily:ABC
Chromosome:Chr.17(-): 66970773-67058442 GRCh37
Location:17q24.2
OMIM:612507
OMIM Phenotype:None
Accessions:AL833712,AY028899
Nucleotide RefSeq:NM_080283
Protein RefSeq:NP_525022
Entrez:10350
Ensembl:ENSG00000154258
Isoforms:5
Evidence:Substrate In Vivo Evidence: 1. ABCA9 was cloned from human macrophages. ABCA9 expression is induced during monocyte differentiation into macrophages and suppressed by cholesterol import, suggesting that ABCA9 is likely involved in monocyte differentiation and macrophage lipid homeostasis. Piehler, A et al. Biochem Biophys Res Comm 2002 Jul 12, 295(2):408-16 PMID 12150964. Tissue Distribution Evidence: 1. Ubiquitous expression with highest mRNA levels in heart, brain, and fetal tissues (RNA dot blot). Piehler, A et al. Biochem Biophys Res Comm 2002 Jul 12, 295(2):408-16 PMID 12150964.
Tissues:heart, brain, fetal tissues, ubiquitous
Type:protein-coding
Sets:0
PharmGKB ID:PA24384
HPRD ID:12401
Substrates:unknown
Trivial Names:EST640918
Transcripts:NM_080283.3 [Chr.17(-): 66970773-67057136 GRCh37]
XM_005256936.1 [Chr.17(-): 66970773-67058441 GRCh37]
XM_005256934.1 [Chr.17(-): 66970773-67058441 GRCh37]
XM_005256935.1 [Chr.17(-): 66970773-67058441 GRCh37]
XM_005256937.1 [Chr.17(-): 66980203-67058442 GRCh37]
ENST00000340001 [Chr.17(-): 66970629-67057205 GRCh37]
ENST00000370732 [Chr.17(-): 66970774-67057136 GRCh37]
ENST00000453985 [Chr.17(-): 66970773-67057065 GRCh37]
ENST00000460872 [Chr.17(-): 66986066-66988823 GRCh37]
ENST00000461623 [Chr.17(-): 67028742-67045498 GRCh37]
ENST00000482072 [Chr.17(-): 66982749-66985282 GRCh37]
ENST00000492580 [Chr.17(-): 67007966-67013913 GRCh37]
ENST00000495634 [Chr.17(-): 67039056-67057047 GRCh37]
ENST00000585714 [Chr.17(-): 67045459-67057090 GRCh37]
Annotation History:View Events (35)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for ABCA9.

Variant Data

View all PMT variants for ABCA9 on UCSC Genome Browser
Showing SNP features for transcript:   
ABCA9 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:ABCA9 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 
67057493 GRCh37
64569088 NCBI36
-357-10226
ATATATATGTTATATATATATATAT T → ATT TTAAGTGACAAGTAAATACATACAA
+ 
 
n=
T/T=
T/ATT=
ATT/ATT=
ATT=
136
68
0
0
0.000
136
68
0
0
0.000
132
65
1
0
0.008
134
67
0
0
0.000
PMT-272
PromoterPDE
67057319 GRCh37
64568914 NCBI36
-183-10052
GGACATATCAAAACATTAGGAACTA T → A CAAACCAAGGAGAATCTAGCCTTTC
+ 
 
n=
T/T=
T/A=
A/A=
A=
136
68
0
0
0.000
136
68
0
0
0.000
132
65
1
0
0.008
134
67
0
0
0.000
PMT-272
PromoterPDEI
67057288 GRCh37
64568883 NCBI36
-152-10021
GCAGGGAGTTTGTAGTTGCAGATGG T → C TGGCTGGACATATCAAAACATTAGG
+ 
 
n=
T/T=
T/C=
C/C=
C=
136
48
20
0
0.147
136
9
33
26
0.625
132
36
23
7
0.280
134
11
33
23
0.590
PMT-272
PromoterPDE
67057285 GRCh37
64568880 NCBI36
-149-10018
TCAGCAGGGAGTTTGTAGTTGCAGA T → C GGTTGGCTGGACATATCAAAACATT
+ 
 
n=
T/T=
T/C=
C/C=
C=
136
68
0
0
0.000
136
67
1
0
0.007
132
66
0
0
0.000
134
67
0
0
0.000
PMT-272
PromoterPDE
67057183 GRCh37
64568778 NCBI36
-47-9916
CCCAGGAGAATTTGGTCTCAGTTCA G → T CTAGCCTGCCAAAATATCTTCTGCT
+ 
 
n=
G/G=
G/T=
T/T=
T=
136
68
0
0
0.000
136
68
0
0
0.000
132
65
1
0
0.008
134
67
0
0
0.000
PMT-272
PromoterPDEI
67057169 GRCh37
64568764 NCBI36
-33-9902
TTTTATACAAATTTCCCAGGAGAAT T → C TGGTCTCAGTTCAGCTAGCCTGCCA
+ 
 
n=
T/T=
T/C=
C/C=
C=
136
41
25
2
0.213
136
65
3
0
0.022
132
66
0
0
0.000
134
67
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.