UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:M-ABC2
HGNC Symbol:ABCB10
HGNC Description:ATP-binding cassette, sub-family B (MDR/TAP), member 10
HGNC ID:41
Superfamily:ABC
Chromosome:Chr.1(-): 229652329-229694442 GRCh37
Location:1q42.13
OMIM:605454
OMIM Phenotype:None
Accessions:AF216833
Nucleotide RefSeq:NM_012089
Protein RefSeq:NP_036221
Entrez:23456
Ensembl:ENSG00000135776
Isoforms:1
Evidence:Tissue Distribution Evidence: 1. Bone marrow > skeletal muscle, small intestine, thyroid, heart, brain, placenta, liver, pancreas, prostate, testis, ovary, leukocyte, stomach, spinal cord, lymph node, trachea, andrenal gland >> lung, kidney, spleen, thymus, colon - Northern Blot, Zhang F et al, FEBS, 2000: 89-94
Tissues:High: bone marrow. Intermediate: skeletal muscle, small intestine, thyroid, heart, brain, placenta, liver, pancreas, prostate, testis, ovary, leukocyte, stomach, spinal cord, lymph node, trachea, adrenal gland. Low: lung, kidney, spleen, thymus, colon.
Type:protein-coding
Sets:0
PharmGKB ID:PA24385
HPRD ID:09263
Substrates:Could function as a nucleotide-gated channel for K+ uptake into mitochondria
Trivial Names:M-ABC2, MTABC2, EST20237
Transcripts:NM_012089.2 [Chr.1(-): 229652329-229694442 GRCh37]
ENST00000344517 [Chr.1(-): 229652329-229694442 GRCh37]
ENST00000486755 [Chr.1(-): 229661809-229667649 GRCh37]
ENST00000498158 [Chr.1(-): 229653544-229654850 GRCh37]

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for ABCB10.

Variant Data

View all PMT variants for ABCB10 on UCSC Genome Browser
Showing SNP features for transcript: NM_012089  
ABCB10 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:ABCB10 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
229694866 GRCh37
227761489 NCBI36
-424-467
GAGCTCTTTCTCACGCCGGCAGACC G → A GGCGGAGCGCGCAGACGCGACCACA
+ 
 
n=
G/G=
G/A=
A/A=
A=
72
24
10
2
0.194
78
37
0
2
0.051
94
45
0
2
0.043
84
38
1
3
0.083
PMT-272
 PDE
229694740 GRCh37
227761363 NCBI36
-298-341
GAGCGCCGGGCGCGCCAGCTGGGAC G → A AGGCCCGGGAAGCCCAGGAGCACGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
72
36
0
0
0.000
78
39
0
0
0.000
94
46
1
0
0.011
84
42
0
0
0.000
PMT-272
PromoterPDE
229694565 GRCh37
227761188 NCBI36
-123-166

C → CGCCCGCCCCC, CGCCCGC
TGCCTGCACCCTCGGGCTGCGCCCG C → CGCCCGC CCCCGCCCCATCCTCGTCCGCGCGG
TGCCTGCACCCTCGGGCTGCGCCCG C → CGCCCGCCCCC CCCCGCCCCATCCTCGTCCGCGCGG
+ 

 
 
 
n=
C/C=
C/CGCCCGC=
CGCCCGC/CGCCCGC=
C/CGCCCGCCCCC=
CGCCCGCCCCC/CGCCCGCCCCC=
CGCCCGC/CGCCCGCCCCC=
CGCCCGC=
CGCCCGCCCCC=
130
13
28
23
1
0
0
0.569
0.008
130
37
26
2
0
0
0
0.231
0.000
132
46
19
1
0
0
0
0.159
0.000
132
42
24
0
0
0
0
0.182
0.000
PMT-272
PromoterPDE
229694485 GRCh37
227761108 NCBI36
-43-86
CCCTCCCGGCCCGGCCCCGAGCAAA G → A GGCGTGGACGCGGTGGCGCCCGCCC
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
65
0
0
0.000
130
65
0
0
0.000
132
65
1
0
0.008
132
66
0
0
0.000
PMT-272
PromoterPDE
229694472 GRCh37
227761095 NCBI36
-30-73
CAAAGCCCGAGGACCCTCCCGGCCC G → C GCCCCGAGCAAAGGGCGTGGACGCG
+ 
 
n=
G/G=
G/C=
C/C=
C=
130
65
0
0
0.000
130
65
0
0
0.000
132
65
1
0
0.008
132
66
0
0
0.000
PMT-272
Exon 1: 5UTR
Promoter
PDE
229694422 GRCh37
227761045 NCBI36
21-23
CATGGCGCTGCGTGCGACCCGTACG C → T CTCAGCCCGCCGGCCAGGCGCGCGC
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
65
0
0
0.000
130
64
1
0
0.008
132
66
0
0
0.000
132
66
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.