UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:BSEP
HGNC Symbol:ABCB11
HGNC Description:ATP-binding cassette, sub-family B (MDR/TAP), member 11
HGNC ID:42
Superfamily:ABC
Chromosome:Chr.2(-): 169779336-169887833 GRCh37
Location:2q24
OMIM:603201
OMIM Phenotype:Progressive intrahepatic cholestasis-2
Accessions:AF091582
Nucleotide RefSeq:NM_003742
Protein RefSeq:NP_003733
Entrez:8647
Ensembl:ENSG00000073734
Isoforms:2
Evidence:Substrate In Vitro Evidence: 1. Transport assays using baculovirus-infected Sf9 cells demonstrated high affinity of BSEP for the bile salt taurochlorate (Km 4.25 uM). Inhibition constants for other bile salts were 11 uM for glycocholate, 7 uM for glycochenodeoxycholate, and 28 uM for taurochenodeoxycholate. Taurochlorate transport was competitively inhibited by CsA (Ki 0.5 uM), rifampicin (Ki 31 uM), and glibenclamide (Ki 27.5 uM). Byrne, JA et al. Gastroenterology 2002 Nov, 123(5):1649-58 PMID 12404239 2. Seven PFIC2-associated missense mutations were introduced into rat BSEP. Localization and transport function of the expressed protein were studied in MDCK and Sf9 cells. Five mutations altered protein trafficking. Three mutations abolished transport activity, perhaps due to protein misfolding. One mutation caused rapid (possibly proteasome-mediated) degradation of BSEP. Wang, L; Soroka, CJ; Boyer, JL. J Clin Invest 2002 Oct, 110(7):965-72 PMID 12370274 Substrate In Vivo Evidence: 1. Mutations in ABCB11 are responsible for progressive familial cholestasis (PFIC2), a cholestatic disorder causing severe liver disease in children. Genotype/phenotype studies in patients with polymorphic forms of ABCB11 are ongoing. Thompson, R; Strautnieks, S. Semin Liver Dis 2001 Nov, 21(4):545-50 PMID 11745042 (review) Tissue Distribution Evidence: 1. Northern blotting revealed dominant (if not exclusive) rat BSEP expression in the liver; in situ immunofluorescence studies demonstrated more specifically expression in the canalicular microvilli and subcanalicular vesicles of hepatocytes. Gerloff, T et al. JBC 1998 Apr 17, 273(16):10046-50 2. Northern blotting revealed exclusive expression of mouse BSEP in the liver. Green, RM; Hoda, F; Ward, KL. Gene 2000 Jan 4, 241(1):117-23 PMID 10607905
Tissues:liver
Type:protein-coding
Sets:I,IV
PharmGKB ID:PA374
HPRD ID:04436
Substrates:bile salts
Trivial Names:BSEP, PGY4, SPGP, ABC16, BRIC2, PFIC2, PFIC-2
Transcripts:NM_003742.2 [Chr.2(-): 169779449-169887833 GRCh37]
XM_005246930.1 [Chr.2(-): 169779336-169828542 GRCh37]
ENST00000263817 [Chr.2(-): 169779448-169887832 GRCh37]
ENST00000439188 [Chr.2(-): 169779893-169828542 GRCh37]
ENST00000478354 [Chr.2(-): 169826033-169827101 GRCh37]
Annotation History:View Events (10)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for ABCB11.

Variant Data

View all PMT variants for ABCB11 on UCSC Genome Browser
Showing SNP features for transcript:   
ABCB11 RESEQUENCING  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:ABCB11 RESEQUENCING
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
PromoterPDEI
169887968 GRCh37
169596214 NCBI36
-135-13333
CCCTCAGAGGGTTTCCCAAGCACAC T → C CTGTGTTTGGGGTTATTGCTCTGAG
- 
 
n=
T/T=
T/C=
C/C=
C=
130
65
0
0
0.000
130
65
0
0
0.000
130
41
21
3
0.208
130
61
3
1
0.038
n/a
0.000
PMT-272
Exon 1: 5UTRPDE
169887775 GRCh37
169596021 NCBI36
59-13140
AAACCTTTTAACTCTCCACAGTGGA G → A TCCATTATTTCCTCTGGCTTCCTCA
- 
 
n=
G/G=
G/A=
A/A=
A=
130
65
0
0
0.000
130
65
0
0
0.000
130
65
0
0
0.000
130
64
1
0
0.008
n/a
0.000
PMT-272
 PDE
169873326 GRCh37
169581572 NCBI36
  
TATTATTAACTGCTTTTTTGCGTTG A → - TTTTTTTTTCTGACAGATAATAATG
- 
 
n=
A/A=
A/-=
-/-=
-=
200
94
6
0
0.030
200
100
0
0
0.000
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDEI
169873236 GRCh37
169581482 NCBI36
  
CATCTTTTCTAGAATAACTCCATAA T → C ATTCATATCAAAGGCACAAAGCAGA
- 
 
n=
T/T=
T/C=
C/C=
C=
194
97
0
0
0.000
200
99
1
0
0.005
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDEI
169870882 GRCh37
169579128 NCBI36
  
ATTGGAAAGGGTGGTCTTTAAATCC T → C TATGTTTTTCTCATCAGGTTACAAG
- 
 
n=
T/T=
T/C=
C/C=
C=
200
46
46
8
0.310
198
85
14
0
0.071
60
25
5
0
0.083
20
9
1
0
0.050
14
6
1
0
0.071
Set-I
Exon 4: CodingPDE3 pubsI
169870855 GRCh37
169579101 NCBI36
234108
ATGTTTTTCTCATCAGGTTACAAGA T → C GAGAAGAAAGGTGATGGCGTTAGAG
-36
Asp = Asp
n=
T/T=
T/C=
C/C=
C=
200
97
3
0
0.015
198
96
3
0
0.015
60
16
13
1
0.250
20
9
1
0
0.050
14
5
1
1
0.214
Set-I
Exon 5: CodingPDEIA
169870004 GRCh37
169578250 NCBI36
293167
TTTTTCAAGTTTCGGTTTTCTTCAT C → T AACTGACATTTGGCTGATGTTTGTG
-56
Ser → Leu
(D=145)
n=
C/C=
C/T=
T/T=
T=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 5: CodingPDEI
169869997 GRCh37
169578243 NCBI36
300174
AGTTTCGGTTTTCTTCATCAACTGA C → T ATTTGGCTGATGTTTGTGGGAAGTT
-58
Asp = Asp
n=
C/C=
C/T=
T/T=
T=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 5: CodingPDE6 pubsIA
169869901 GRCh37
169578147 NCBI36
396270
TTTTTGGCACAATGACAGATGTTTT T → C ATTGACTACGACGTTGAGTTACAAG
-90
Phe = Phe
n=
T/T=
T/C=
C/C=
C=
200
94
6
0
0.030
200
93
7
0
0.035
60
27
3
0
0.050
20
10
0
0
0.000
14
6
1
0
0.071
Set-I
 PDE1 pub
169869774 GRCh37
169578020 NCBI36
  
AAATGGAACACGTTGTGGGTAGGTT G → A TTTTTGTTTTTAATTTTTTACTTTT
- 
 
n=
G/G=
G/A=
A/A=
A=
200
90
10
0
0.050
200
99
1
0
0.005
60
30
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
Exon 6: CodingPDE1 pubI
169853220 GRCh37
169561466 NCBI36
528402
CCCTCTTTTGAAGGTTGCTGAACAT C → T GAGAGCGAAATGATCAAATTTGCCA
-134
Ile = Ile
n=
C/C=
C/T=
T/T=
T=
200
95
3
2
0.035
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE1 pubI
169853129 GRCh37
169561375 NCBI36
  
ATATATTCAAGTTAGTAGCTCCTCC G → A TATAATTTATAGATCAATATCTGAC
- 
 
n=
G/G=
G/A=
A/A=
A=
200
95
3
2
0.035
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 7: CodingPDEI
169851885 GRCh37
169560131 NCBI36
711585
TAGGGTGGTTTGACTGCAATTCAGT G → C GGGGAGCTGAATACAAGATTCTCTG
-195
Val = Val
n=
G/G=
G/C=
C/C=
C=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 8: CodingPDE2 pubsI
169850388 GRCh37
169558634 NCBI36
742616
CAAAATCTTTCTGGTTTCTAGTGAT A → G TTAATAAAATCAATGATGCCATAGC
-206
Ile → Val
(D=29)
n=
A/A=
A/G=
G/G=
G=
200
96
3
1
0.025
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 8: CodingPDE
169850308 GRCh37
169558554 NCBI36
822696
TGACCTCGACCATCTGTGGTTTCCT G → T TTGGGATTTTTCAGGGGTTGGAAAC
-232
Leu = Leu
n=
G/G=
G/T=
T/T=
T=
200
100
0
0
0.000
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 9: CodingPDE3 pubsIA
169847412 GRCh37
169555658 NCBI36
933807
AGAGTGTGTCCAAGTTTACGGACTA T → C GAGCTGAAGGCCTATGCCAAAGCAG
-269
Tyr = Tyr
n=
T/T=
T/C=
C/C=
C=
200
96
4
0
0.020
200
99
1
0
0.005
60
17
12
1
0.233
20
9
1
0
0.050
14
5
1
1
0.214
Set-I
Exon 9: CodingPDE19 pubsI
169847329 GRCh37
169555575 NCBI36
1016890
AGAACAGTGGCTGCTTTTGGTGGTG A → G GAAAAGAGAGGTTGAAAGGTTGGTT
-297
Glu → Gly
(D=98)
n=
A/A=
A/G=
G/G=
G=
200
100
0
0
0.000
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE1 pub
169842811 GRCh37
169551057 NCBI36
  
GCTGTTTCTGCCGAAATTGACTCAA G → A CATTTTGTCTTCACAGGTATGAGAA
- 
 
n=
G/G=
G/A=
A/A=
A=
200
53
36
11
0.290
200
100
0
0
0.000
50
25
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
 PDE3 pubsI
169842809 GRCh37
169551055 NCBI36
  
TGTTTCTGCCGAAATTGACTCAAGC A → G TTTTGTCTTCACAGGTATGAGAAAA
- 
 
n=
A/A=
A/G=
G/G=
G=
200
3
29
68
0.825
200
8
42
50
0.710
50
0
5
20
0.900
20
2
6
2
0.500
14
0
0
7
1.000
Set-I
Exon 10: CodingPDE6 pubsIA
169842746 GRCh37
169550992 NCBI36
1083957
CCCAGCGTTGGGGAATTAGAAAAGG A → G ATAGTGATGGGATTCTTTACTGGAT
-319
Gly = Gly
n=
A/A=
A/G=
G/G=
G=
200
48
41
11
0.315
200
99
1
0
0.005
50
25
0
0
0.000
20
7
3
0
0.150
14
7
0
0
0.000
Set-I
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 PDE1 pub
169842602 GRCh37
169550848 NCBI36
  
TTGTCCAGGTACCTTGGACTTATTG A → T CCGAGACATAGCATTTCCTTCTGGT
- 
 
n=
A/A=
A/T=
T/T=
T=
198
83
16
0
0.081
200
100
0
0
0.000
46
23
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDEI
169836514 GRCh37
169544760 NCBI36
  
ATTTACACATTAACAAAAACACATG A → T AAAATCTCTCTCTTTTCATTTCAGA
- 
 
n=
A/A=
A/T=
T/T=
T=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 12: CodingPDEI
169833114 GRCh37
169541360 NCBI36
14071281
AAATTGAATTCCATAATGTGACCTT C → T CATTATCCTTCCAGACCAGAGGTGA
-427
Phe = Phe
n=
C/C=
C/T=
T/T=
T=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 13: CodingPDE37 pubsI
169830328 GRCh37
169538574 NCBI36
14571331
CAGATTCTAAATGACCTCAACATGG T → C CATTAAACCAGGGGAAATGACAGCT
-444
Val → Ala
(D=64)
n=
T/T=
T/C=
C/C=
C=
200
20
54
26
0.530
198
10
65
24
0.571
60
1
18
11
0.667
20
3
4
3
0.500
14
0
1
6
0.929
Set-I
 PDEI
169828325 GRCh37
169536571 NCBI36
  
CTAGCCATACATTCCTGGGAGAAAC T → C AAGAGGTCATAGAAGGAAAAAAAGT
- 
 
n=
T/T=
T/C=
C/C=
C=
196
18
50
30
0.561
188
17
36
41
0.628
58
0
12
17
0.793
20
4
3
3
0.450
14
0
1
6
0.929
Set-I
Exon 15: CodingPDE
169826693 GRCh37
169534939 NCBI36
17971671
ACACCCTTGTTGGAGAAGGAGGAGG C → T CAGATGAGTGGTGGCCAGAAACAAA
-557
Gly = Gly
n=
C/C=
C/T=
T/T=
T=
200
100
0
0
0.000
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 15: CodingPDE2 pubs
169826690 GRCh37
169534936 NCBI36
18001674
CCCTTGTTGGAGAAGGAGGAGGCCA G → C ATGAGTGGTGGCCAGAAACAAAGGG
-558
Gln → His
(D=24)
n=
G/G=
G/C=
C/C=
C=
200
100
0
0
0.000
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 15: CodingPDE6 pubsI
169826592 GRCh37
169534838 NCBI36
18981772
GACATGGCCACCTCAGCTCTGGACA A → G TGAGAGTGAAGCCATGGTGCAAGAA
-591
Asn → Ser
(D=46)
n=
A/A=
A/G=
G/G=
G=
200
100
0
0
0.000
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 15: CodingPDE
169826590 GRCh37
169534836 NCBI36
19001774
CATGGCCACCTCAGCTCTGGACAAT G → C AGAGTGAAGCCATGGTGCAAGAAGT
-592
Glu → Gln
(D=29)
n=
G/G=
G/C=
C/C=
C=
200
100
0
0
0.000
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 15: CodingPDE2 pubsI
169826573 GRCh37
169534819 NCBI36
19171791
TGGACAATGAGAGTGAAGCCATGGT G → T CAAGAAGTGCTGAGTAAGGTTTGTG
-597
Val = Val
n=
G/G=
G/T=
T/T=
T=
200
100
0
0
0.000
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 17: CodingPDE7 pubsA
169824983 GRCh37
169533229 NCBI36
21552029
TTGAGTAGATGCAACTGAAGATGAC A → G TGCTTGCGAGGACCTTTAGCAGAGG
-677
Met → Val
(D=21)
n=
A/A=
A/G=
G/G=
G=
200
71
28
1
0.150
200
89
11
0
0.055
60
29
1
0
0.017
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
 PDE2 pubsIA
169814655 GRCh37
169522901 NCBI36
  
GAGTACATTTAGATGATTAATATAA C → A CCTCTCTCTGCTCAAGGACAAGGAC
- 
 
n=
C/C=
C/A=
A/A=
A=
198
42
51
6
0.318
198
34
56
9
0.374
52
4
16
6
0.538
20
3
5
2
0.450
14
3
4
0
0.286
Set-I
 
169801506 GRCh37
169509752 NCBI36
  
TAAATAGATTTATTTTTCTATTTAT A → AATA ATAAAGTTACTTTCTTGCTTACTAT
- 
 
n=
A/A=
A/AATA=
AATA/AATA=
AATA=
200
82
18
0
0.090
198
99
0
0
0.000
60
30
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
 PDE
169801504 GRCh37
169509750 NCBI36
  
AATAGATTTATTTTTCTATTTATAA T → C AAAGTTACTTTCTTGCTTACTATCT
- 
 
n=
T/T=
T/C=
C/C=
C=
200
82
18
0
0.090
198
99
0
0
0.000
60
30
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
 PDE1 pubA
169801488 GRCh37
169509734 NCBI36
  
TATTTATAATAAAGTTACTTTCTTG C → T TTACTATCTTTCCAAGACTTTTTCA
- 
 
n=
C/C=
C/T=
T/T=
T=
200
86
11
3
0.085
198
46
42
11
0.323
60
30
0
0
0.000
20
7
2
1
0.200
14
3
4
0
0.286
Set-I
Exon 20: CodingPDE2 pubsIA
169801403 GRCh37
169509649 NCBI36
25382412
ATGGTGTGTGCCTACTTTTTGTAGC A → G ATGGGCTGTGTATCTCTTTTCACCC
-804
Ala = Ala
n=
A/A=
A/G=
G/G=
G=
200
84
16
0
0.080
198
99
0
0
0.000
60
30
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
 PDEI
169801097 GRCh37
169509343 NCBI36
  
TTCAAGGGGTGAGCTATGGGAGGGG A → C AATAGAAGTATATTAACTGCATTGG
- 
 
n=
A/A=
A/C=
C/C=
C=
164
82
0
0
0.000
194
96
1
0
0.005
60
30
0
0
0.000
18
9
0
0
0.000
14
7
0
0
0.000
Set-I
 PDEI
169792968 GRCh37
169501214 NCBI36
  
GTAAAAGCGACTGTGTGTCTGAGAC G → A GGTTGATTGCTTTTTGGTTTGCAGG
- 
 
n=
G/G=
G/A=
A/A=
A=
200
99
1
0
0.005
198
99
0
0
0.000
60
27
3
0
0.050
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
Exon 24: CodingPDE9 pubsI
169789016 GRCh37
169497262 NCBI36
32103084
TGATCTCTGCAGTTGTACTGAGTGC A → G ACAGCTCTTGGAAGAGCCTTCTCTT
-1028
Ala = Ala
n=
A/A=
A/G=
G/G=
G=
196
49
42
7
0.286
194
20
48
29
0.546
60
4
14
12
0.633
16
4
2
2
0.375
14
4
3
0
0.214
Set-I
Exon 25: CodingPDE1 pub
169787328 GRCh37
169495574 NCBI36
33843258
TTGATTTTGTTGATTGTAAATTTAC A → G TATCCTTCTCGACCTGACTCGCAAG
-1086
Thr = Thr
n=
A/A=
A/G=
G/G=
G=
200
87
12
1
0.070
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 26: CodingPDEI
169783849 GRCh37
169492095 NCBI36
35613435
AGATGATAGATGGTCATGACAGCAA A → G AAAGTAAATGTCCAGTTCCTCCGCT
-1145
Lys = Lys
n=
A/A=
A/G=
G/G=
G=
200
98
2
0
0.010
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 26: CodingPDE2 pubsI
169783728 GRCh37
169491974 NCBI36
36823556
AGACAACACCAAAGAAATTCCCATG G → A AAAGAGTCATAGCAGCTGCAAAACA
-1186
Glu → Lys
(D=56)
n=
G/G=
G/A=
A/A=
A=
200
95
5
0
0.025
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE1 pubI
169780366 GRCh37
169488612 NCBI36
  
ATGGTGGGCTGGGGAGCAATCATGC G → A TCTTTGCATCAACTTTCCATCTTCT
- 
 
n=
G/G=
G/A=
A/A=
A=
186
7
40
46
0.710
186
27
48
18
0.452
60
12
14
4
0.367
18
3
3
3
0.500
14
0
3
4
0.786
Set-I
Exon 28: 3UTR2 pubsI
169779896 GRCh37
169488142 NCBI36
4328 
CCACTTGACATTGGGTTTTCCCTCA T → C ATGGACCCTAGTTTCTTTCATTTTC
+ 
 
n=
T/T=
T/C=
C/C=
C=
134
7
29
31
0.679
128
12
38
14
0.516
132
1
7
58
0.932
130
9
26
30
0.662
n/a
0.000
PMT-272
Exon 28: 3UTR
169779816 GRCh37
169488062 NCBI36
4408 
CTCCCTGATGTCTCACTAATTCCCA C → T ATATTAATCAGGACTGGCTCCTGCA
+ 
 
n=
C/C=
C/T=
T/T=
T=
134
67
0
0
0.000
128
64
0
0
0.000
132
65
1
0
0.008
130
65
0
0
0.000
n/a
0.000
PMT-272
Exon 28: 3UTR1 pubI
169779764 GRCh37
169488010 NCBI36
4460 
TTCAAAAATGAAAGACAGTTCTCTG C → T CCTTGAGGAGTTCAAAGTGTCACTT
+ 
 
n=
C/C=
C/T=
T/T=
T=
134
36
23
8
0.291
128
13
37
14
0.508
132
8
27
31
0.674
130
11
30
24
0.600
n/a
0.000
PMT-272
Exon 28: 3UTR
169779719 GRCh37
169487965 NCBI36
4505 
TTTGTTGATTGCCTGTTATAGACCC G → A CCTCTGTGTACACCGAGGGTTCAAA
+ 
 
n=
G/G=
G/A=
A/A=
A=
134
66
1
0
0.007
128
64
0
0
0.000
132
66
0
0
0.000
130
65
0
0
0.000
n/a
0.000
PMT-272
Exon 28: 3UTR1 pubI
169779712 GRCh37
169487958 NCBI36
4512 
AGAAACGTTTGTTGATTGCCTGTTA T → C AGACCCGCCTCTGTGTACACCGAGG
+ 
 
n=
T/T=
T/C=
C/C=
C=
134
36
23
8
0.291
128
12
38
14
0.516
132
8
26
32
0.682
130
11
30
24
0.600
n/a
0.000
PMT-272
Exon 28: 3UTR
169779692 GRCh37
169487938 NCBI36
4532 
TCTGACCTTGGTCTAGCTCAAGAAA C → T GTTTGTTGATTGCCTGTTATAGACC
+ 
 
n=
C/C=
C/T=
T/T=
T=
134
67
0
0
0.000
128
64
0
0
0.000
132
66
0
0
0.000
130
64
1
0
0.008
n/a
0.000
PMT-272
Exon 28: 3UTR
169779505 GRCh37
169487751 NCBI36
4719 
TAAAGCATAAATCAACAGCCCTAAC T → G GGAAAGCTCATGCTAATACTTTCCC
+ 
 
n=
T/T=
T/G=
G/G=
G=
134
67
0
0
0.000
128
63
1
0
0.008
132
66
0
0
0.000
130
65
0
0
0.000
n/a
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.