UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:MDR3
HGNC Symbol:ABCB4
HGNC Description:ATP-binding cassette, sub-family B (MDR/TAP), member 4
HGNC ID:45
Superfamily:ABC
Chromosome:Chr.7(-): 87031361-87105019 GRCh37
Location:7q21.1
OMIM:171060
OMIM Phenotype:Cholestasis, familial intrahepatic, of pregnancy; Cholestasis, progressive familial intrahepatic, type III; Cholelithiasis
Accessions:M23234, Z35284
Nucleotide RefSeq:NM_000443
Protein RefSeq:NP_000434
Entrez:5244
Ensembl:ENSG00000005471
Isoforms:3
Evidence:Substrate In Vitro Evidence: Phosphatidylcholine (PC) 1. PC-tp transfer to liposomes. A.J. Smith, et al. FEBS Lett. 1994; 354: 263-266. 2. Polarized LLC-PK1 transfected with MDR3. A. van Helvoort, et al. Cell. 1996; 87: 507-517. Digoxin - Polarized LLC-PK1 transfected with MDR3. A.J. Smith, et al. JBC. 2000; 275: 23530-39. Vinblastine - Polarized LLC-PK1 transfected with MDR3. A.J. Smith, et al. JBC. 2000; 275: 23530-39. Paclitaxel - Polarized LLC-PK1 transfected with MDR3. A.J. Smith, et al. JBC. 2000; 275: 23530-39. Aureobasidin A - Yeast expression. Kino K, et al. FEBS Lett. 1996; 399: 29-32. Substrate In Vivo Evidence: Phosphatidylcholine 1. Progressive familial intrahepatic cholestasis (PFIC) in humans. J.M.L. De Vree, et al. PNAS. 1998; 95: 282-287. 2. mdr2 K.O. mouse. J.J.M. Smit, et al. Cell. 1993; 75: 451-462. Tissue Distribution Evidence: Liver 1. Western Blot. J.J.M. Smit, et al. Lab. Invest. 1994; 71: 638-649. 2. TaqMan RT-PCR. Langmann T. Clinical Chemistry. 2003; 49: 230-8. Adrenal Gland and Spleen 1. TaqMan RT-PCR. Langmann T. Clinical Chemistry. 2003; 49: 230-8.
Tissues:Liver, Adrenal Gland, Spleen
Type:protein-coding
Sets:I,V
PharmGKB ID:PA268
HPRD ID:01371
Substrates:Phosphatidylcholine, Digoxin, Vinblastine, Paclitaxel, Aureobasidin A
Trivial Names:GBD1, ICP3, MDR2, MDR3, PGY3, ABC21, MDR2/3, PFIC-3
Transcripts:NM_000443.3 [Chr.7(-): 87031361-87105019 GRCh37]
NM_018849.2 [Chr.7(-): 87031361-87105019 GRCh37]
NM_018850.2 [Chr.7(-): 87031361-87105019 GRCh37]
ENST00000265723 [Chr.7(-): 87031365-87105055 GRCh37]
ENST00000358400 [Chr.7(-): 87031361-87105019 GRCh37]
ENST00000359206 [Chr.7(-): 87031361-87104975 GRCh37]
ENST00000417608 [Chr.7(-): 87092177-87109751 GRCh37]
ENST00000440025 [Chr.7(-): 87031013-87032517 GRCh37]
ENST00000453593 [Chr.7(-): 87031412-87104781 GRCh37]
ENST00000467079 [Chr.7(-): 87035236-87037550 GRCh37]
ENST00000467983 [Chr.7(-): 87031450-87032695 GRCh37]
ENST00000469770 [Chr.7(-): 87052891-87060816 GRCh37]
ENST00000473795 [Chr.7(-): 87081688-87104788 GRCh37]
ENST00000545634 [Chr.7(-): 87031412-87104781 GRCh37]
Annotation History:View Events (4)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for ABCB4.

Variant Data

View all PMT variants for ABCB4 on UCSC Genome Browser
Showing SNP features for transcript:   
ABCB4 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:ABCB4 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 PDE
87105276 GRCh37
86943212 NCBI36
-257-495
GGTCGCAGGATAAGACCGAGATCAG C → G CTGGAGCCTCGGGTGCCGAGAAAGC
+ 
 
n=
C/C=
C/G=
G/G=
G=
132
36
20
10
0.303
122
14
13
34
0.664
132
13
15
38
0.689
126
12
12
39
0.714
n/a
0.000
PMT-272
PromoterPDE
87105195 GRCh37
86943131 NCBI36
-176-414
AGGGGCGCAGCCTGCCGCTCTTGCC G → A CCGGGGCGCCCGGCTGGGGCCGCCG
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
35
24
7
0.288
120
55
1
4
0.075
132
56
2
8
0.136
126
57
3
3
0.071
n/a
0.000
PMT-272
PromoterPDE
87105176 GRCh37
86943112 NCBI36
-157-395
CCCAGGCTAGGCGCGGGCCAGGGGC G → C CAGCCTGCCGCTCTTGCCGCCGGGG
+ 
 
n=
G/G=
G/C=
C/C=
C=
132
18
25
23
0.538
120
48
4
8
0.167
130
53
4
8
0.154
126
54
5
4
0.103
n/a
0.000
PMT-272
PromoterPDE
87105159 GRCh37
86943095 NCBI36
-140-378
GCCCGCCCAGCTCTCTCCCCAGGCT A → G GGCGCGGGCCAGGGGCGCAGCCTGC
+ 
 
n=
A/A=
A/G=
G/G=
G=
132
59
7
0
0.053
118
47
9
3
0.127
130
43
14
8
0.231
126
39
19
5
0.230
n/a
0.000
PMT-272
PromoterPDE
87105087 GRCh37
86943023 NCBI36
-68-306
CGCGTCCGGCCCGGGAAACGCCTAC C → A GTTGCAGCCAGGGCGAGGGCCGCGG
+ 
 
n=
C/C=
C/A=
A/A=
A=
132
66
0
0
0.000
114
57
0
0
0.000
130
62
1
2
0.038
124
62
0
0
0.000
n/a
0.000
PMT-272
 PDE
87104791 GRCh37
86942727 NCBI36
 -10
TTGGTTCTGAGGCTGTGGTTTCTCC T → C CAGGCTGAGATGGATCTTGAGGCGG
- 
 
n=
T/T=
T/C=
C/C=
C=
188
83
11
0
0.059
194
97
0
0
0.000
56
28
0
0
0.000
16
8
0
0
0.000
12
6
0
0
0.000
Set-I
 PDE
87102007 GRCh37
86939943 NCBI36
  
TTTGTAACAGTTTTAAATTGAAGCA A → G TTCTATTTTTTACAGCAAACAAAAA
- 
 
n=
A/A=
A/G=
G/G=
G=
186
89
4
0
0.022
186
93
0
0
0.000
60
30
0
0
0.000
14
7
0
0
0.000
10
5
0
0
0.000
Set-I
Exon 4: CodingPDEI
87092213 GRCh37
86930149 NCBI36
223147
TTTCCTTTTTTTAGTTTCGATACTC C → T GATTGGCAGGATAAATTGTTTATGT
-49
Ser = Ser
n=
C/C=
C/T=
T/T=
T=
200
91
9
0
0.045
198
98
1
0
0.005
60
30
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
Exon 4: CodingPDE2 pubsI
87092185 GRCh37
86930121 NCBI36
251175
TTGGCAGGATAAATTGTTTATGTCG C → T TGGGTACCATCATGGCCATAGCTCA
-59
Leu = Leu
n=
C/C=
C/T=
T/T=
T=
200
32
52
16
0.420
198
72
26
1
0.141
60
27
3
0
0.050
20
8
2
0
0.100
14
0
4
3
0.714
Set-I
Exon 4: CodingPDEI
87092143 GRCh37
86930079 NCBI36
293217
CATAGCTCACGGATCAGGTCTCCCC C → G TCATGATGATAGTATTTGGAGAGAT
-73
Leu → Val
(D=32)
n=
C/C=
C/G=
G/G=
G=
200
100
0
0
0.000
198
98
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 4: CodingPDEI
87092120 GRCh37
86930056 NCBI36
316240
CCCTCATGATGATAGTATTTGGAGA G → A ATGACTGACAAATTTGTTGATACTG
-80
Glu = Glu
n=
G/G=
G/A=
A/A=
A=
200
100
0
0
0.000
198
98
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 6: CodingPDE3 pubsIA
87082292 GRCh37
86920228 NCBI36
580504
AGGAAATAGGATGGTTTGACATCAA C → T GACACCACTGAACTCAATACGCGGC
-168
Asn = Asn
n=
C/C=
C/T=
T/T=
T=
200
100
0
0
0.000
200
100
0
0
0.000
60
29
0
1
0.033
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
87082249 GRCh37
86920185 NCBI36
  
TACGCGGCTAACAGAGTAGGTACAT T → C GTTAATGTCACACTTTCATATAGAA
- 
 
n=
T/T=
T/C=
C/C=
C=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 7: CodingPDEI
87080951 GRCh37
86918887 NCBI36
772696
GCCCTATTCTAGGACTCTCTGCAGC C → T GTTTGGGCAAAGGTATGTGAAAGCT
-232
Ala = Ala
n=
C/C=
C/T=
T/T=
T=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 8: CodingPDE4 pubs
87079406 GRCh37
86917342 NCBI36
787711
ATCACTGTTTCTTTTCTGTCCAGAT A → T CTCTCGGCATTTAGTGACAAAGAAC
-237
Ile = Ile
n=
A/A=
A/T=
T/T=
T=
200
48
50
2
0.270
200
66
31
3
0.185
58
21
8
0
0.138
20
8
2
0
0.100
14
0
4
3
0.714
Set-I
Exon 8: CodingPDE
87079405 GRCh37
86917341 NCBI36
788712
TCACTGTTTCTTTTCTGTCCAGATA C → G TCTCGGCATTTAGTGACAAAGAACT
-238
Leu → Val
(D=32)
n=
C/C=
C/G=
G/G=
G=
200
97
3
0
0.015
200
100
0
0
0.000
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 12: CodingPDE
87072677 GRCh37
86910613 NCBI36
13901314
GTAGTGGCTGTGGGAAGAGCACAAC G → A GTCCAGCTGATACAGAGGCTCTATG
-438
Thr = Thr
n=
G/G=
G/A=
A/A=
A=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
87072609 GRCh37
86910545 NCBI36
  
GTAAGTGGGAAGAACCAAGCTTTCC A → G GAGTGGGAAGCTGGATACAAATTGG
- 
 
n=
A/A=
A/G=
G/G=
G=
200
93
7
0
0.035
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
87072600 GRCh37
86910536 NCBI36
  
AAGAACCAAGCTTTCCAGAGTGGGA A → G GCTGGATACAAATTGGCCCTTTGAA
- 
 
n=
A/A=
A/G=
G/G=
G=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDEIA
87069758 GRCh37
86907694 NCBI36
  
AATGGTCCTGATACTTCAGCTATTA A → G ATGGTTAAATACTTAATAGGAAATA
- 
 
n=
A/A=
A/G=
G/G=
G=
192
0
9
87
0.953
184
0
17
75
0.908
60
2
10
18
0.767
20
0
1
9
0.950
14
4
3
0
0.214
Set-I
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 PDE
87069480 GRCh37
86907416 NCBI36
  
CTGATAAAGTAGTTGTCCTTGAAAT T → C AGAATTTCACCTCATAGGACTGAGT
- 
 
n=
T/T=
T/C=
C/C=
C=
192
94
2
0
0.010
192
96
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 14: CodingPDE3 pubs
87069130 GRCh37
86907066 NCBI36
16601584
AGAAATTTGACACCCTGGTTGGAGA G → C AGAGGGGCCCAGCTGAGTGGTGGGC
-528
Glu → Asp
(D=45)
n=
G/G=
G/C=
C/C=
C=
200
93
6
1
0.040
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDEI
87060714 GRCh37
86898650 NCBI36
  
TCAAACTTGTCAACATGCAGGTACT T → C GCTTTTCAGGAATTTTTTCTGCTAT
- 
 
n=
T/T=
T/C=
C/C=
C=
200
100
0
0
0.000
200
98
2
0
0.010
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 16: CodingPDE
87056178 GRCh37
86894114 NCBI36
20281952
GAACTAAATGATGAAAAGGCTGCCA C → A TAGAATGGCCCCAAATGGCTGGAAA
-651
Thr → Asn
(D=65)
n=
C/C=
C/A=
A/A=
A=
200
100
0
0
0.000
198
99
0
0
0.000
60
29
1
0
0.017
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 16: CodingPDE6 pubsI
87056176 GRCh37
86894112 NCBI36
20301954
ACTAAATGATGAAAAGGCTGCCACT A → G GAATGGCCCCAAATGGCTGGAAATC
-652
Arg → Gly
(D=125)
n=
A/A=
A/G=
G/G=
G=
200
42
49
9
0.335
198
80
19
0
0.096
60
28
2
0
0.033
20
8
1
1
0.150
14
7
0
0
0.000
Set-I
 PDEI
87053206 GRCh37
86891142 NCBI36
  
GATCATAGCGGTAAGTTTGCAAACA C → T CACATAACAGCCTGAATTAGATCAA
- 
 
n=
C/C=
C/T=
T/T=
T=
196
2
9
87
0.934
196
0
16
82
0.918
54
2
9
16
0.759
20
0
1
9
0.950
14
4
3
0
0.214
Set-I
Exon 19: CodingPDE
87049383 GRCh37
86887319 NCBI36
24012325
CCTTTTTTCTCAACCAGGGTTTCAC G → C TTTGGGAAAGCTGGCGAGATCCTCA
-775
Thr = Thr
n=
G/G=
G/C=
C/C=
C=
200
93
7
0
0.035
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 19: CodingPDEI
87049345 GRCh37
86887281 NCBI36
24392363
GGCGAGATCCTCACCAGAAGACTGC G → A GTCAATGGCTTTTAAAGCAATGCTA
-788
Arg → Gln
(D=43)
n=
G/G=
G/A=
A/A=
A=
200
86
11
3
0.085
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
87047991 GRCh37
86885927 NCBI36
  
TGGAGCTTTGGGAGGCTTTGTCTGG T → G TTTCTTTGCTTGTTTTAATTTTGAA
- 
 
n=
T/T=
T/G=
G/G=
G=
194
96
1
0
0.005
198
99
0
0
0.000
36
18
0
0
0.000
16
8
0
0
0.000
8
4
0
0
0.000
Set-I
 PDE
87047957 GRCh37
86885893 NCBI36
  
CTTGTTTTAATTTTGAACTAACATA A → G ACGTGTATTTTATGCCATAGGACAT
- 
 
n=
A/A=
A/G=
G/G=
G=
194
95
2
0
0.010
198
99
0
0
0.000
36
18
0
0
0.000
16
8
0
0
0.000
8
4
0
0
0.000
Set-I
 PDEI
87047813 GRCh37
86885749 NCBI36
  
CTCTACTTGTAGTTTTTTACATAAC A → G TGGTTTTAGATAAGCATGTAGCATA
- 
 
n=
A/A=
A/G=
G/G=
G=
198
63
34
2
0.192
196
79
19
0
0.097
32
14
2
0
0.063
10
4
1
0
0.100
6
3
0
0
0.000
Set-I
 PDE
87041185 GRCh37
86879121 NCBI36
  
CTGTAAGTAGCTTTAGAAATATTAA G → A ATTATTCTATAATAAGGTTTTAGTA
- 
 
n=
G/G=
G/A=
A/A=
A=
200
99
1
0
0.005
198
99
0
0
0.000
56
28
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 24: CodingPDE
87038681 GRCh37
86876617 NCBI36
30282952
TGTTTTCTGCAATTGTATTTGGTGC A → G GTGGCTCTAGGACATGCCAGTTCAT
-984
Ala = Ala
n=
A/A=
A/G=
G/G=
G=
200
97
3
0
0.015
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 25: CodingPDEI
87037521 GRCh37
86875457 NCBI36
31873111
AATTTGAAGGAAATATAACATTTAA T → C GAAGTCGTGTTCAACTATCCCACCC
-1037
Asn = Asn
n=
T/T=
T/C=
C/C=
C=
200
98
2
0
0.010
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 25: CodingPDE
87037488 GRCh37
86875424 NCBI36
32203144
TGTTCAACTATCCCACCCGAGCAAA C → T GTGCCAGTGCTTCAGGGGCTGAGCC
-1048
Asn = Asn
n=
C/C=
C/T=
T/T=
T=
200
100
0
0
0.000
200
100
0
0
0.000
60
29
1
0
0.017
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
87035594 GRCh37
86873530 NCBI36
  
CGAGACGTTACCCCACGTAAGTTAA A → - GAGTAGCTGAAATCAGAAGAGACTA
- 
 
n=
A/A=
A/-=
-/-=
-=
200
100
0
0
0.000
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE1 pubI
87032613 GRCh37
86870549 NCBI36
  
AACAGTTCATTCAACATATTTATAA T → C TTGGTTAACTTGCAGAAATATGAAA
- 
 
n=
T/T=
T/C=
C/C=
C=
200
1
7
92
0.955
200
0
23
77
0.885
58
1
10
18
0.793
20
1
1
8
0.850
14
5
1
1
0.214
Set-I
Exon 27: CodingPDEI
87032531 GRCh37
86870467 NCBI36
36293553
AGGAGGTCAAAAACAGAGGATTGCT A → G TTGCCCGAGCCCTCATCAGACAACC
-1185
Ile → Val
(D=29)
n=
A/A=
A/G=
G/G=
G=
200
100
0
0
0.000
200
99
1
0
0.005
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDEI
87032405 GRCh37
86870341 NCBI36
  
TATGTCTTATTTAATTTATGAAATA G → T AAGGGATTTTGCTGTCAACCATGAA
- 
 
n=
G/G=
G/T=
T/T=
T=
200
100
0
0
0.000
200
99
1
0
0.005
56
28
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.