UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:ABCB5
HGNC Symbol:ABCB5
HGNC Description:ATP-binding cassette, sub-family B (MDR/TAP), member 5
HGNC ID:46
Superfamily:ABC
Chromosome:Chr.7(+): 20655245-20796637 GRCh37
Location:7p21.1
OMIM:611785
OMIM Phenotype:None
Accessions:AY234788
Nucleotide RefSeq:NM_178559
Protein RefSeq:NP_848654
Entrez:340273
Ensembl:ENSG00000004846
Isoforms:5
Evidence:Substrate In Vitro Evidence: Rhodamine - FACS analysis on MCF-7 cells transfected with gene. Frank NY, et al. J Biol Chem. 2003 Nov 21; 278(47): 47156-65. Tissue Distribution Evidence: Testis, Prostate, Uterus - TaqMan RT-PCR. Langmann T, et al. Clinical Chemistry. 2003; 49: 230-8.
Tissues:Testis, Prostate, Uterus
Type:protein-coding
Sets:0
PharmGKB ID:PA24387
HPRD ID:
Substrates:Rhodamine
Trivial Names:ABCB5beta, EST422562, ABCB5alpha
Transcripts:NM_178559.5 [Chr.7(+): 20686966-20796637 GRCh37]
NM_001163941.1 [Chr.7(+): 20655245-20796637 GRCh37]
NM_001163993.1 [Chr.7(+): 20686966-20707187 GRCh37]
NM_001163942.1 [Chr.7(+): 20686966-20700017 GRCh37]
XM_005249737.1 [Chr.7(+): 20686930-20796637 GRCh37]
ENST00000258738 [Chr.7(+): 20687045-20795247 GRCh37]
ENST00000404938 [Chr.7(+): 20654830-20796632 GRCh37]
ENST00000406935 [Chr.7(+): 20686966-20706946 GRCh37]
ENST00000441315 [Chr.7(+): 20762717-20816658 GRCh37]
ENST00000443026 [Chr.7(+): 20686966-20700017 GRCh37]
ENST00000477094 [Chr.7(+): 20686953-20691319 GRCh37]

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for ABCB5.

Variant Data

View all PMT variants for ABCB5 on UCSC Genome Browser
Showing SNP features for transcript:   
ABCB5 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:ABCB5 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
20686643 GRCh37
20653168 NCBI36
-323-4403
TCCTAGCTTGAGGGATTCTTTTCTT A → C TTTGACTTTTTGCAGAGATGAGTCT
+ 
 
n=
A/A=
A/C=
C/C=
C=
134
66
1
0
0.007
136
68
0
0
0.000
130
65
0
0
0.000
124
62
0
0
0.000
PMT-272
PromoterPDEI
20686910 GRCh37
20653435 NCBI36
-56-4136
ATAACCACAAGACTATGAGATAATC A → G AAAGTTGTTCCTTATTAGGAAAAGG
+ 
 
n=
A/A=
A/G=
G/G=
G=
134
30
27
10
0.351
136
68
0
0
0.000
130
65
0
0
0.000
124
56
5
1
0.056
PMT-272
Exon 1: 5UTRPDEIA
20687181 GRCh37
20653706 NCBI36
216-3865
AGGTTTTCTTTAGTGTAATCCATAG C → T AGTTATTGCATTGGAGCAGCAGTCC
+ 
 
n=
C/C=
C/T=
T/T=
T=
118
23
22
14
0.424
128
41
23
0
0.180
126
60
3
0
0.024
94
38
6
3
0.128
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.