UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:ABC14
HGNC Symbol:ABCB6
HGNC Description:ATP-binding cassette, sub-family B (MDR/TAP), member 6
HGNC ID:47
Superfamily:ABC
Chromosome:Chr.2(-): 220074488-220083712 GRCh37
Location:2q36
OMIM:605452
OMIM Phenotype:None
Accessions:AF070598,AJ289233
Nucleotide RefSeq:NM_005689
Protein RefSeq:NP_005680
Entrez:10058
Ensembl:ENSG00000115657
Isoforms:3
Evidence:Substrate In Vitro Evidence: 1. Transient transfection of ABCB6 promoter constructs containing the luciferase gene resulted in an 1100-2300-fold increase compared to empty vector. Further experiments demonstrated that the promoter is orientation-dependent. Emadi-Konjin, HP et al. Biochim Biophys Acta 2002 Mar 19, 1574(2):117-30 PMID 11955620. Substrate In Vivo Evidence: 1. MTABC3 (mammalian mitochondrial ABC protein 3) is a half-transporter that transfer a precursor of the iron-sulfur cluster from mitochondria to the cytosol in yeast. The 2q36 region is within the candidate locus for lethal neonatal metabolic syndrome, a disorder of mitochondrial function associated with iron metabolism. Mitsuhashi, N et al. JBC 2000 Jun 9, 275(23):17536-40 PMID 10837493. 2. ABCB6 is not the causative gene for the growth retardation syndrome with amindoaciduria, cholestasis, iron overload, and lactacidosis (GRACILE). No mutations in the ABCB6 coding region were found, and expression level in fibroblasts were comparable between patients and controls. Vispaa, I et al. Am J Med Genet 2002 May 1, 109(3):202-5 PMID 11977179. Tissue Distribution Evidence: 1. Northern blots demonstrate that ABCB6 is expressed ubiquitously, but at low levels in normal human liver. ABCB6 is overexpressed in human hepatocellular carcinomas compared to paired surrounding non-malignant tissue. Emadi-Konjin, HP et al. Biochim Biophys Acta 2002 Mar 19, 1574(2):117-30 PMID 11955620.
Tissues:ubiquitous, hepatocellular carcinomas
Type:protein-coding
Sets:0
PharmGKB ID:PA24388
HPRD ID:09261
Substrates:Fe/S cluster precursor
Trivial Names:ABC, LAN, PRP, DUH3, umat, ABC14, MTABC3, MCOPCB7
Transcripts:NM_005689.2 [Chr.2(-): 220074488-220083712 GRCh37]
XM_005246215.1 [Chr.2(-): 220074488-220083680 GRCh37]
XM_005246216.1 [Chr.2(-): 220075208-220083680 GRCh37]
ENST00000265316 [Chr.2(-): 220074490-220083712 GRCh37]
ENST00000295750 [Chr.2(-): 220074494-220083076 GRCh37]
ENST00000417678 [Chr.2(-): 220078890-220083148 GRCh37]
ENST00000439002 [Chr.2(-): 220074494-220083672 GRCh37]
ENST00000443805 [Chr.2(-): 220074498-220075760 GRCh37]
ENST00000448398 [Chr.2(-): 220077962-220083198 GRCh37]
ENST00000452545 [Chr.2(-): 220079751-220082912 GRCh37]
ENST00000485773 [Chr.2(-): 220074494-220075830 GRCh37]
ENST00000487380 [Chr.2(-): 220074494-220075761 GRCh37]
ENST00000492543 [Chr.2(-): 220075433-220078142 GRCh37]
ENST00000492953 [Chr.2(-): 220078863-220081010 GRCh37]
ENST00000494639 [Chr.2(-): 220078324-220079405 GRCh37]
ENST00000496984 [Chr.2(-): 220078620-220080159 GRCh37]
ENST00000497882 [Chr.2(-): 220074494-220080607 GRCh37]
Annotation History:View Events (19)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for ABCB6.

Variant Data

View all PMT variants for ABCB6 on UCSC Genome Browser
Showing SNP features for transcript:   
ABCB6 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:ABCB6 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDEI
220084192 GRCh37
219792436 NCBI36
-480-797
CGAGTTCGGGCAGCGCAATTCACCA C → T TCTCCCAAAGCCGGACCACAGCTGG
+ 
 
n=
C/C=
C/T=
T/T=
T=
132
66
0
0
0.000
134
67
0
0
0.000
136
67
1
0
0.007
132
66
0
0
0.000
PMT-272
 PDE
220084190 GRCh37
219792434 NCBI36
-478-795
TCCGAGTTCGGGCAGCGCAATTCAC C → T ACTCTCCCAAAGCCGGACCACAGCT
+ 
 
n=
C/C=
C/T=
T/T=
T=
132
65
1
0
0.008
134
67
0
0
0.000
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
 PDE
220084083 GRCh37
219792327 NCBI36
-371-688
TTTCTCTTGTTCCCAGGATTCTAGC C → T GCGCGAGACAACAAGAAGTCTGGTC
+ 
 
n=
C/C=
C/T=
T/T=
T=
132
66
0
0
0.000
134
66
1
0
0.007
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
 PDE
220084003 GRCh37
219792247 NCBI36
-291-608
CCGCCAGCCGCCTTGCTCAGCGTAT C → T TGAGCGACGGCCTAAACATACTTTC
+ 
 
n=
C/C=
C/T=
T/T=
T=
132
64
2
0
0.015
134
67
0
0
0.000
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
 PDE
220083969 GRCh37
219792213 NCBI36
-257-574
ACCTCCACGGAACTGTGGGTCGGAA G → A CTGCCCTTCCGCCAGCCGCCTTGCT
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
66
0
0
0.000
134
67
0
0
0.000
136
68
0
0
0.000
132
65
1
0
0.008
PMT-272
PromoterPDEI
220083814 GRCh37
219792058 NCBI36
-102-419
GCAGGCAACGAATGCAAATTAGAGA G → A GCAGAGCCGGCTTGGTCACGTGCCC
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
57
9
0
0.068
134
67
0
0
0.000
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
PromoterPDE
220083743 GRCh37
219791987 NCBI36
-31-348
GCCCCGCCCACAGCCCCTACCCACG G → A CTCCCATTGGCCAAATGTCTCCGAG
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
66
0
0
0.000
134
67
0
0
0.000
136
68
0
0
0.000
132
65
1
0
0.008
PMT-272
Exon 1: 5UTR
Promoter
PDE
220083705 GRCh37
219791949 NCBI36
8-310
TGCTCGGTGTTGGACTCGCACCGCG C → A TCCACGGCTGTAGCCCCGCCCACAG
+ 
 
n=
C/C=
C/A=
A/A=
A=
132
65
1
0
0.008
134
67
0
0
0.000
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.