UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:ABC7
HGNC Symbol:ABCB7
HGNC Description:ATP-binding cassette, sub-family B (MDR/TAP), member 7
HGNC ID:48
Superfamily:ABC
Chromosome:Chr.X(-): 74273007-74376175 GRCh37
Location:Xq13.3
OMIM:300135
OMIM Phenotype:Anemia, sideroblastic, and spinocerebellar ataxia
Accessions:AF038950.1, AB005289.1
Nucleotide RefSeq:NM_004299
Protein RefSeq:NP_004290
Entrez:22
Ensembl:ENSG00000131269
Isoforms:5
Evidence:Substrate In Vitro Evidence: 1. Transient expression of ANC7 n mouse embryo liver BNL-CL2 cells resulted in an increase in the level and activity of ferrochelatase (the last enzyme in the pathway to synthesize heme) and thioredoxin (a cytosolic protein containing Fe/S). ABC7 expression therefore contributes to the production of heme during the differentiation of erythroid cells. Taketani, S et al. Blood 2003 Apr 15, 101(8):3274-80 PMID 12480705. Substrate In Vivo Evidence: 1. A SNP (I400M) in ABC7 was linked with X-linked sideroblastic anemia and ataxia (XLSA/A), a recessive disorder characterized by onset of non-progressive cerebellar ataxia and mild anemia. Allikmets, R et al. Hum Mol Genet. 8(5):743-9 PMID 10196363. 2. ABC7 plays a central role in the maturation of cytosolic iron-sulfur cluster-containing proteins. Bekri, S et al. Blood 2000 Nov 1, 96(9):3256-64 PMID 11050011. Tissue Distribution Evidence: 1. Targeting signal indicates that the ABC7 gene product is likely to be located in the mitochondrial inner membrane. Shimada, Y et al. J Hum Genet 1998, 43(2):115-22 PMID 9621516.
Tissues:mitochondrial inner membrane
Type:protein-coding
Sets:II
PharmGKB ID:PA24389
HPRD ID:02137
Substrates:iron?
Trivial Names:ABC7, ASAT, Atm1p, EST140535
Transcripts:NM_004299.4 [Chr.X(-): 74273007-74376175 GRCh37]
NM_001271698.1 [Chr.X(-): 74273007-74376175 GRCh37]
NM_001271697.1 [Chr.X(-): 74273007-74376175 GRCh37]
NM_001271696.1 [Chr.X(-): 74273007-74376175 GRCh37]
NM_001271699.1 [Chr.X(-): 74273007-74376175 GRCh37]
ENST00000253577 [Chr.X(-): 74273115-74376132 GRCh37]
ENST00000339447 [Chr.X(-): 74273117-74376114 GRCh37]
ENST00000373394 [Chr.X(-): 74273119-74376115 GRCh37]
ENST00000469368 [Chr.X(-): 74288891-74291416 GRCh37]
ENST00000490858 [Chr.X(-): 74273299-74282462 GRCh37]
ENST00000526404 [Chr.X(-): 74296467-74376567 GRCh37]
ENST00000529949 [Chr.X(-): 74273280-74376117 GRCh37]
ENST00000534524 [Chr.X(-): 74295321-74376121 GRCh37]
ENST00000534570 [Chr.X(-): 74285043-74293737 GRCh37]
Annotation History:View Events (43)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for ABCB7.

Variant Data

View all PMT variants for ABCB7 on UCSC Genome Browser
Showing SNP features for transcript:   
ABCB7 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:ABCB7 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
PromoterPDEIA
74376420 GRCh37
74293145 NCBI36
-245-313
CAATTTTACATAAACAACGAATCAT T → C TCTTCGTGCGTGTGTCCCAAATATT
+ 
 
n=
T/T=
T/C=
C/C=
C=
132
42
15
9
0.250
134
67
0
0
0.000
132
66
0
0
0.000
132
65
1
0
0.008
PMT-272
PromoterPDE
74376281 GRCh37
74293006 NCBI36
-106-174
AGCCTCTTTTATTTGTTTTTCCTTA G → A GGCCGAGCTTTGATTGTTTTCCTTA
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
65
0
1
0.015
134
67
0
0
0.000
132
66
0
0
0.000
132
66
0
0
0.000
PMT-272
PromoterPDE
74376196 GRCh37
74292921 NCBI36
-21-89
TACCTTAATTGTCTCTCCTCTTCTT G → C TTTTCCCAGGGCCCCAGACCGGAAA
+ 
 
n=
G/G=
G/C=
C/C=
C=
132
54
10
2
0.106
134
67
0
0
0.000
132
66
0
0
0.000
132
65
0
1
0.015
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.