UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:MABC1
HGNC Symbol:ABCB8
HGNC Description:ATP-binding cassette, sub-family B (MDR/TAP), member 8
HGNC ID:49
Superfamily:ABC
Chromosome:Chr.7(+): 150725510-150744869 GRCh37
Location:7q36
OMIM:605464
OMIM Phenotype:None
Accessions:AF047690,AK002018
Nucleotide RefSeq:NM_007188
Protein RefSeq:NP_009119
Entrez:11194
Ensembl:ENSG00000197150
Isoforms:7
Evidence:Substrate In Vitro Evidence: 1. Peptides, 9-11mers (streptoysin O-permeabilized cells), Momburg F et al, Journal of Experimental Medicine, 1994: 1613-23
Tissues:None
Type:protein-coding
Sets:0
PharmGKB ID:PA24390
HPRD ID:10400
Substrates:Peptides (9-11mer)
Trivial Names:MABC1, M-ABC1, EST328128
Transcripts:NM_007188.3 [Chr.7(+): 150725510-150744869 GRCh37]
XM_005249936.1 [Chr.7(+): 150725510-150744869 GRCh37]
XM_005249939.1 [Chr.7(+): 150725519-150744869 GRCh37]
XM_005249935.1 [Chr.7(+): 150725530-150744869 GRCh37]
XM_005249937.1 [Chr.7(+): 150725537-150744869 GRCh37]
XM_005249938.1 [Chr.7(+): 150725888-150744869 GRCh37]
XM_005249940.1 [Chr.7(+): 150730139-150744869 GRCh37]
ENST00000297504 [Chr.7(+): 150725537-150742649 GRCh37]
ENST00000356058 [Chr.7(+): 150725549-150742649 GRCh37]
ENST00000358849 [Chr.7(+): 150725510-150744869 GRCh37]
ENST00000461373 [Chr.7(+): 150725510-150730929 GRCh37]
ENST00000462605 [Chr.7(+): 150725537-150730329 GRCh37]
ENST00000466514 [Chr.7(+): 150725537-150742649 GRCh37]
ENST00000466956 [Chr.7(+): 150725537-150731686 GRCh37]
ENST00000469410 [Chr.7(+): 150725744-150730147 GRCh37]
ENST00000470645 [Chr.7(+): 150725537-150739117 GRCh37]
ENST00000471796 [Chr.7(+): 150725537-150730121 GRCh37]
ENST00000472698 [Chr.7(+): 150725560-150728713 GRCh37]
ENST00000477092 [Chr.7(+): 150725554-150734657 GRCh37]
ENST00000477719 [Chr.7(+): 150725551-150734611 GRCh37]
ENST00000482309 [Chr.7(+): 150725513-150742496 GRCh37]
ENST00000482899 [Chr.7(+): 150734775-150742649 GRCh37]
ENST00000488370 [Chr.7(+): 150725563-150730785 GRCh37]
ENST00000488551 [Chr.7(+): 150725563-150731634 GRCh37]
ENST00000488826 [Chr.7(+): 150725524-150730837 GRCh37]
ENST00000489192 [Chr.7(+): 150725525-150731638 GRCh37]
ENST00000491920 [Chr.7(+): 150732706-150734673 GRCh37]
ENST00000493338 [Chr.7(+): 150730017-150731684 GRCh37]
ENST00000498578 [Chr.7(+): 150725549-150742650 GRCh37]
ENST00000542328 [Chr.7(+): 150725537-150742496 GRCh37]

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for ABCB8.

Variant Data

View all PMT variants for ABCB8 on UCSC Genome Browser
Showing SNP features for transcript:   
ABCB8 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:ABCB8 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
PromoterPDE
150725500 GRCh37
150356433 NCBI36
-10-103
TGTCTTTTCACCAATCACCGCCAAG G → T CGCGAGGGGGTTGTCGGGATGGGGG
+ 
 
n=
G/G=
G/T=
T/T=
T=
132
66
0
0
0.000
132
65
1
0
0.008
136
67
1
0
0.007
130
65
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.