UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:TAPL
HGNC Symbol:ABCB9
HGNC Description:ATP-binding cassette, sub-family B (MDR/TAP), member 9
HGNC ID:50
Superfamily:ABC
Chromosome:Chr.12(-): 123405498-123451056 GRCh37
Location:12q24
OMIM:605453
OMIM Phenotype:None
Accessions:AB112582,AF216494,AK074738,BC064384
Nucleotide RefSeq:NM_019625
Protein RefSeq:NP_062571
Entrez:23457
Ensembl:ENSG00000150967
Isoforms:7
Evidence:None
Tissues:High in testes. Moderate in brain and spinal cord
Type:protein-coding
Sets:0
PharmGKB ID:PA24391
HPRD ID:09262
Substrates:None
Trivial Names:TAPL, EST122234
Transcripts:NM_019624.3 [Chr.12(-): 123413539-123451056 GRCh37]
NM_019625.3 [Chr.12(-): 123413539-123451056 GRCh37]
NM_203444.3 [Chr.12(-): 123409072-123451056 GRCh37]
NM_001243014.1 [Chr.12(-): 123405498-123451056 GRCh37]
NM_001243013.1 [Chr.12(-): 123413539-123451056 GRCh37]
XM_005253559.1 [Chr.12(-): 123413539-123444660 GRCh37]
XM_005253558.1 [Chr.12(-): 123413539-123444660 GRCh37]
ENST00000280560 [Chr.12(-): 123413541-123451043 GRCh37]
ENST00000344275 [Chr.12(-): 123405498-123451007 GRCh37]
ENST00000346530 [Chr.12(-): 123413541-123451056 GRCh37]
ENST00000392439 [Chr.12(-): 123413546-123459752 GRCh37]
ENST00000426173 [Chr.12(-): 123415873-123444334 GRCh37]
ENST00000442028 [Chr.12(-): 123413547-123459752 GRCh37]
ENST00000442833 [Chr.12(-): 123409072-123451007 GRCh37]
ENST00000536976 [Chr.12(-): 123428938-123435552 GRCh37]
ENST00000537276 [Chr.12(-): 123416188-123450949 GRCh37]
ENST00000538895 [Chr.12(-): 123423996-123444807 GRCh37]
ENST00000540285 [Chr.12(-): 123413541-123451047 GRCh37]
ENST00000540971 [Chr.12(-): 123425493-123433859 GRCh37]
ENST00000541424 [Chr.12(-): 123430723-123437631 GRCh37]
ENST00000541983 [Chr.12(-): 123424673-123429249 GRCh37]
ENST00000542448 [Chr.12(-): 123419820-123431024 GRCh37]
ENST00000542678 [Chr.12(-): 123413547-123466196 GRCh37]
ENST00000543935 [Chr.12(-): 123444586-123459229 GRCh37]
ENST00000545373 [Chr.12(-): 123424754-123429219 GRCh37]
ENST00000546077 [Chr.12(-): 123428942-123433118 GRCh37]
ENST00000546289 [Chr.12(-): 123414558-123429222 GRCh37]
Annotation History:View Events (46)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for ABCB9.

Variant Data

View all PMT variants for ABCB9 on UCSC Genome Browser
Showing SNP features for transcript:   
ABCB9 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:ABCB9 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
123451374 GRCh37
122017327 NCBI36
-318-6592
CAGCTTTTTAACTGGCCTTTTTCCC T → A GGAGGGACAGCCAGCCAGTCCAGGA
+ 
 
n=
T/T=
T/A=
A/A=
A=
130
65
0
0
0.000
128
64
0
0
0.000
134
66
1
0
0.007
128
64
0
0
0.000
PMT-272
 
123451373 GRCh37
122017326 NCBI36
-317-6591
CCAGCTTTTTAACTGGCCTTTTTCC C → - TGGAGGGACAGCCAGCCAGTCCAGG
+ 
 
n=
C/C=
C/-=
-/-=
-=
130
64
1
0
0.008
128
64
0
0
0.000
134
67
0
0
0.000
128
64
0
0
0.000
PMT-272
Promoter
123451135 GRCh37
122017088 NCBI36
-79-6353
GGGCCTCAGGAGGAGTGGGCGGGCT T → C TCCTGGACGGGGCGGGGCCCCCGAG
+ 
 
n=
T/T=
T/C=
C/C=
C=
130
40
24
1
0.200
128
64
0
0
0.000
134
67
0
0
0.000
128
62
2
0
0.016
PMT-272
Exon 1: 5UTR
Promoter
PDE
123451018 GRCh37
122016971 NCBI36
39-6236
AAGGTCGGAGCTGAGACTGGCGTGC C → G TTGAGACAGGCTGATGGACGGGGCG
+ 
 
n=
C/C=
C/G=
G/G=
G=
130
3
13
49
0.854
126
25
28
10
0.381
132
36
26
4
0.258
128
18
38
8
0.422
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.