UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:ABCC10
HGNC Symbol:ABCC10
HGNC Description:ATP-binding cassette, sub-family C (CFTR/MRP), member 10
HGNC ID:52
Superfamily:ABC
Chromosome:Chr.6(+): 43395282-43418163 GRCh37
Location:6p21.1
OMIM:612509
OMIM Phenotype:None
Accessions:NM_033450
Nucleotide RefSeq:NM_033450
Protein RefSeq:NP_258261
Entrez:89845
Ensembl:ENSG00000124574
Isoforms:8
Evidence:Substrate In Vitro Evidence: 1. MgATP dependent transport of E217?G in HEK293 cells, Chen ZS et al, Molecular Pharmacology, 2003: 351-358 Tissue Distribution Evidence: 1. High in colon, skin, testis - RT/PCR, Hopper E et al, Cancer Letters, 2001: 181-191
Tissues:colon, skin, testis
Type:protein-coding
Sets:V
PharmGKB ID:PA24392
HPRD ID:07623
Substrates:E217b-G
Trivial Names:MRP7, SIMRP7, EST182763
Transcripts:NM_033450.2 [Chr.6(+): 43399489-43418163 GRCh37]
NM_001198934.1 [Chr.6(+): 43395292-43418163 GRCh37]
XM_005249465.1 [Chr.6(+): 43395282-43418160 GRCh37]
XM_005249466.1 [Chr.6(+): 43395282-43417242 GRCh37]
XM_005249468.1 [Chr.6(+): 43395282-43415412 GRCh37]
XM_005249467.1 [Chr.6(+): 43395282-43414606 GRCh37]
XM_005249470.1 [Chr.6(+): 43395282-43412608 GRCh37]
XM_005249469.1 [Chr.6(+): 43406075-43418160 GRCh37]
ENST00000244533 [Chr.6(+): 43399489-43418163 GRCh37]
ENST00000372512 [Chr.6(+): 43412838-43415175 GRCh37]
ENST00000372515 [Chr.6(+): 43395104-43409635 GRCh37]
ENST00000372530 [Chr.6(+): 43395292-43418168 GRCh37]
ENST00000437104 [Chr.6(+): 43414593-43415600 GRCh37]
ENST00000443426 [Chr.6(+): 43395594-43402894 GRCh37]
ENST00000463024 [Chr.6(+): 43403536-43418164 GRCh37]
ENST00000469856 [Chr.6(+): 43406449-43409799 GRCh37]
ENST00000502549 [Chr.6(+): 43395286-43399914 GRCh37]
ENST00000505344 [Chr.6(+): 43415731-43418160 GRCh37]
Annotation History:View Events (51)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for ABCC10.

Variant Data

View all PMT variants for ABCC10 on UCSC Genome Browser
Showing SNP features for transcript:   
ABCC10 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:ABCC10 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
43399081 GRCh37
43507059 NCBI36
-408-767
AATGAATATGTACCCTTTATCAGTT A → TA TCTGCATGAAAACTTTGGATTTTCT
+ 
 
n=
A/A=
A/TA=
TA/TA=
TA=
134
50
17
0
0.127
132
66
0
0
0.000
128
64
0
0
0.000
124
62
0
0
0.000
PMT-272
 PDE
43399117 GRCh37
43507095 NCBI36
-372-731
AACTTTGGATTTTCTTTTTTTTCCT G → A AGACGGAGTCTTCCCCTGTCACCCA
+ 
 
n=
G/G=
G/A=
A/A=
A=
100
49
1
0
0.010
132
66
0
0
0.000
128
64
0
0
0.000
124
62
0
0
0.000
PMT-272
Exon 1: 5UTRPDE
43399544 GRCh37
43507522 NCBI36
56-304
CGTAGTACCCAGGATTTTTTTTTTC C → T TAGTTAGTCTTCATGTTAAGTACAA
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
67
1
0
0.007
134
67
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
PMT-272
Exon 1: 5UTRPDE
43399646 GRCh37
43507624 NCBI36
158-202
AAATGGTGTGGGTAGTTTAGAAAAT G → T AGTTAGGTTCAGGTGGCCGGTTAGC
+ 
 
n=
G/G=
G/T=
T/T=
T=
136
68
0
0
0.000
134
66
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 1: 5UTRPDE
43399739 GRCh37
43507717 NCBI36
251-109
CCTGGGAGAAAAGACCCTGGGTTCT G → C AGGTAAAGTGGAGTAGGGATAAGAT
+ 
 
n=
G/G=
G/C=
C/C=
C=
136
67
1
0
0.007
134
67
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 1: 5UTRPDE
43399768 GRCh37
43507746 NCBI36
280-80
TAAAGTGGAGTAGGGATAAGATGTG C → A AAGGCAGGAAGGGAGTTGATTCCTT
+ 
 
n=
C/C=
C/A=
A/A=
A=
136
68
0
0
0.000
134
66
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 1: 5UTRPDE
43399821 GRCh37
43507799 NCBI36
333-27
GTAAGTGAATTATTGGAGGTGAGGG G → T TATGTCTGGCTCCTGAGTCAGCCAC
+ 
 
n=
G/G=
G/T=
T/T=
T=
136
68
0
0
0.000
134
66
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 1: 5UTRPDEI
43399837 GRCh37
43507815 NCBI36
349-11
AGGTGAGGGGTATGTCTGGCTCCTG A → G GTCAGCCACGATGTGCCTCCTTGTC
+ 
 
n=
A/A=
A/G=
G/G=
G=
136
1
19
48
0.846
134
0
15
52
0.888
136
1
6
61
0.941
136
0
26
42
0.809
PMT-272
Exon 1: CodingPDE
43399949 GRCh37
43507927 NCBI36
461102
GACTTGCAGCTTCCTTCCTGCTTTC C → T GTCTTCCCGCTGCTAGACCTTCTTC
+34
Ser = Ser
n=
C/C=
C/T=
T/T=
T=
136
68
0
0
0.000
134
67
0
0
0.000
136
68
0
0
0.000
136
66
2
0
0.015
PMT-272
Exon 1: CodingPDE
43399958 GRCh37
43507936 NCBI36
470111
CTTCCTTCCTGCTTTCCGTCTTCCC G → T CTGCTAGACCTTCTTCCAGTTGCTT
+37
Pro = Pro
n=
G/G=
G/T=
T/T=
T=
136
68
0
0
0.000
134
67
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
PMT-272
Exon 1: CodingPDE
43400073 GRCh37
43508051 NCBI36
585226
GGCCTGGATCAGCCACAGCCTGGCC C → G TGTGGGTGTTGGCACATTCCCCTCA
+76
Leu → Val
(D=32)
n=
C/C=
C/G=
G/G=
G=
136
68
0
0
0.000
134
67
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
PMT-272
Exon 1: CodingPDE
43400204 GRCh37
43508182 NCBI36
716357
ATTGCCAGCGAGGCACACTTCTGCC C → T CCACTTCTCCCAGGGCCCATGGCCC
+119
Pro = Pro
n=
C/C=
C/T=
T/T=
T=
136
68
0
0
0.000
136
68
0
0
0.000
132
65
1
0
0.008
136
68
0
0
0.000
PMT-272
Exon 1: CodingPDE
43400230 GRCh37
43508208 NCBI36
742383
CCACTTCTCCCAGGGCCCATGGCCC G → A CCTATGCTTGCTCATCCTGCAGCTG
+128
Arg → His
(D=29)
n=
G/G=
G/A=
A/A=
A=
136
68
0
0
0.000
136
67
1
0
0.007
132
66
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 1: CodingPDE
43400342 GRCh37
43508320 NCBI36
854495
CTCAGGAGCCCCTCCTGCCCGAGGA T → G CAAGAACCTGAGGTGGCTGAAGATG
+165
Asp → Glu
(D=45)
n=
T/T=
T/G=
G/G=
G=
136
68
0
0
0.000
136
64
4
0
0.029
132
66
0
0
0.000
136
65
3
0
0.022
PMT-272
Exon 1: CodingPDE
43400500 GRCh37
43508478 NCBI36
1012653
AGACTGCAGCCAACCTACCTGGCTC G → A TGTCTTCCAGGCACACTGGCAGGAG
+218
Arg → His
(D=29)
n=
G/G=
G/A=
A/A=
A=
136
68
0
0
0.000
136
67
1
0
0.007
132
66
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 1: CodingPDE
43400532 GRCh37
43508510 NCBI36
1044685
CCAGGCACACTGGCAGGAGGGGGCA C → T GGCTGTGGAGGGCCTTGTATGGGGC
+229
Arg → Trp
(D=101)
n=
C/C=
C/T=
T/T=
T=
136
68
0
0
0.000
136
68
0
0
0.000
132
65
1
0
0.008
136
68
0
0
0.000
PMT-272
Exon 1: CodingPDE
43400634 GRCh37
43508612 NCBI36
1146787
GTTGGGATTCTCAGGGCCCCTGTTG C → T TCTCCCTACTGGTGGGCTTCCTGGA
+263
Leu → Phe
(D=22)
n=
C/C=
C/T=
T/T=
T=
136
68
0
0
0.000
136
67
1
0
0.007
132
66
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 1: CodingPDE
43400636 GRCh37
43508614 NCBI36
1148789
TGGGATTCTCAGGGCCCCTGTTGCT C → G TCCCTACTGGTGGGCTTCCTGGAAG
+263
Leu = Leu
n=
C/C=
C/G=
G/G=
G=
136
68
0
0
0.000
136
67
1
0
0.007
132
66
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 1: CodingPDE
43400685 GRCh37
43508663 NCBI36
1197838
AGAGGGGCAGGAGCCACTAAGCCAC G → A GCCTGCTCTATGCTCTGGGGCTAGC
+280
Gly → Ser
(D=56)
n=
G/G=
G/A=
A/A=
A=
136
67
1
0
0.007
136
68
0
0
0.000
132
66
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 1: CodingPDE
43400691 GRCh37
43508669 NCBI36
1203844
GCAGGAGCCACTAAGCCACGGCCTG C → T TCTATGCTCTGGGGCTAGCCGGTGG
+282
Leu → Phe
(D=22)
n=
C/C=
C/T=
T/T=
T=
136
67
1
0
0.007
132
66
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
Exon 1: CodingPDE
43400743 GRCh37
43508721 NCBI36
1255896
GCTGTGCTGGGTGCTGTGCTGCAGA A → G TCAGTATGGGTATGAGGTATATAAG
+299
Asn → Ser
(D=46)
n=
A/A=
A/G=
G/G=
G=
136
67
1
0
0.007
132
66
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 1: CodingPDE
43400904 GRCh37
43508882 NCBI36
14161057
CTCTGAACGGCTGCTTAACTTTGCT G → A GGAGCTTCCATGAAGCCTGGGGCCT
+353
Gly → Arg
(D=125)
n=
G/G=
G/A=
A/A=
A=
136
68
0
0
0.000
134
67
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
PMT-272
Exon 1: CodingPDE
43401027 GRCh37
43509005 NCBI36
15391180
CTTGGCACTGCTGCTGGTACCCGTC A → G ACAAAGTGATTGCCACCCGCATCAT
+394
Asn → Asp
(D=23)
n=
A/A=
A/G=
G/G=
G=
136
67
1
0
0.007
134
66
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 1: CodingPDE
43401088 GRCh37
43509066 NCBI36
16001241
CAGGAAATGCTACAGCACAAGGATG C → T GCGGGTTAAGGTGAGCGGGTACTTG
+414
Ala → Val
(D=64)
n=
C/C=
C/T=
T/T=
T=
136
68
0
0
0.000
134
67
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
PMT-272
Exon 1: CodingPDE
43401090 GRCh37
43509068 NCBI36
16021243
GGAAATGCTACAGCACAAGGATGCG C → T GGGTTAAGGTGAGCGGGTACTTGGG
+415
Arg → Trp
(D=101)
n=
C/C=
C/T=
T/T=
T=
136
68
0
0
0.000
134
66
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
 PDEI
43401105 GRCh37
43509083 NCBI36
  
CAAGGATGCGCGGGTTAAGGTGAGC G → A GGTACTTGGGGTCCCTCAGCTATCT
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
46
22
0
0.162
134
17
33
17
0.500
136
13
35
20
0.551
136
18
35
15
0.478
PMT-272
Exon 20: 3UTRPDE
43417852 GRCh37
43525830 NCBI36
4777 
TGAGCCCAATCCCACACCCTGCAGA G → C TTCTCCCCTCTCTCTGATCCAGGCC
+ 
 
n=
G/G=
G/C=
C/C=
C=
134
42
21
4
0.216
136
68
0
0
0.000
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 20: 3UTRPDEI
43418015 GRCh37
43525993 NCBI36
4940 
CTTGGTGGGCAGCATCCTGAGGCTT C → T CCCAGAACCAGGCCTCTGCTCTGGC
+ 
 
n=
C/C=
C/T=
T/T=
T=
134
58
8
1
0.075
136
68
0
0
0.000
136
68
0
0
0.000
132
65
1
0
0.008
PMT-272
 PDE
43418328 GRCh37
43526306 NCBI36
  
CAGGGGGCAAGTCACGTGGCAGGGG G → A AGCCCTGCTGGCAGCATGCTAACCT
+ 
 
n=
G/G=
G/A=
A/A=
A=
134
65
2
0
0.015
136
61
7
0
0.051
136
68
0
0
0.000
132
63
3
0
0.023
PMT-272
 PDE
43418338 GRCh37
43526316 NCBI36
  
GTCACGTGGCAGGGGGAGCCCTGCT G → T GCAGCATGCTAACCTGACACTCCTG
+ 
 
n=
G/G=
G/T=
T/T=
T=
134
67
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
132
65
1
0
0.008
PMT-272
 PDE
43418428 GRCh37
43526406 NCBI36
  
ACAGGGTCCAGGGGGGCAGACACCC C → T GGCGCCAGGCCCTCAGGGTCAGCAA
+ 
 
n=
C/C=
C/T=
T/T=
T=
134
67
0
0
0.000
136
68
0
0
0.000
136
65
3
0
0.022
132
66
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.