UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:ABCC11
HGNC Symbol:ABCC11
HGNC Description:ATP-binding cassette, sub-family C (CFTR/MRP), member 11
HGNC ID:14639
Superfamily:ABC
Chromosome:Chr.16(-): 48200782-48281479 GRCh37
Location:16q12.1
OMIM:607040
OMIM Phenotype:None
Accessions:NM_032583
Nucleotide RefSeq:NM_032583
Protein RefSeq:NP_115972
Entrez:85320
Ensembl:ENSG00000121270
Isoforms:6
Evidence:Substrate In Vitro Evidence: 1. cAMP, cGMP, PMEA and 5-fluorodeoxyuridine monophosphate, LLC-PK vesicles, Guo Y et al, JBC, 2003: 29509-29514 Tissue Distribution Evidence: 1. Breast Cancer, RT/PCR, Bera TK et al, Molecular Medicine, 2001: 509-516
Tissues:breast cancer
Type:protein-coding
Sets:V
PharmGKB ID:PA24393
HPRD ID:06127
Substrates:c-AMP, c-GMP, PMEA, 5-fluordeoxyuridine monophosphate
Trivial Names:WW, EWWD, MRP8
Transcripts:NM_032583.3 [Chr.16(-): 48200822-48269088 GRCh37]
NM_033151.3 [Chr.16(-): 48200822-48266182 GRCh37]
NM_145186.2 [Chr.16(-): 48200822-48269088 GRCh37]
XM_005256209.1 [Chr.16(-): 48200782-48281305 GRCh37]
XM_005256210.1 [Chr.16(-): 48200782-48278133 GRCh37]
XM_005256208.1 [Chr.16(-): 48200782-48278133 GRCh37]
ENST00000353782 [Chr.16(-): 48200821-48269088 GRCh37]
ENST00000356608 [Chr.16(-): 48200821-48281305 GRCh37]
ENST00000394747 [Chr.16(-): 48200822-48266182 GRCh37]
ENST00000394748 [Chr.16(-): 48200822-48269088 GRCh37]
ENST00000537808 [Chr.16(-): 48221111-48281479 GRCh37]
ENST00000565329 [Chr.16(-): 48200821-48221301 GRCh37]
ENST00000565487 [Chr.16(-): 48249143-48257618 GRCh37]
ENST00000567385 [Chr.16(-): 48243264-48278499 GRCh37]
ENST00000569172 [Chr.16(-): 48221301-48232161 GRCh37]
ENST00000569991 [Chr.16(-): 48258259-48281479 GRCh37]
Annotation History:View Events (30)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for ABCC11.

Variant Data

View all PMT variants for ABCC11 on UCSC Genome Browser
Showing SNP features for transcript:   
ABCC11 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:ABCC11 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
48269464 GRCh37
46826965 NCBI36
-376-3632
AACGAGCTCGAGCTCAGCCACACAT T → G AGCTTGGGCCTCCTTCCAGTTCCAT
+ 
 
n=
T/T=
T/G=
G/G=
G=
92
46
0
0
0.000
114
56
1
0
0.009
126
63
0
0
0.000
106
53
0
0
0.000
PMT-272
PromoterPDE
48269333 GRCh37
46826834 NCBI36
-245-3501
AGTGTGACTCTTTCCTATTCAAGAT T → C CATCCAGGAAACTAACGACATGGAA
+ 
 
n=
T/T=
T/C=
C/C=
C=
92
45
1
0
0.011
114
57
0
0
0.000
126
63
0
0
0.000
106
53
0
0
0.000
PMT-272
Promoter
48269141 GRCh37
46826642 NCBI36
-53-3309
CAACTAGAGATGCAAAGAGATGCAA AGAGATGCAA → - TGAGGGTTACTCATCA
+ 
 
n=
AGAGATGCAA/AGAGATGCAA=
AGAGATGCAA/-=
-/-=
-=
132
40
20
6
0.242
130
56
8
1
0.077
136
63
5
0
0.037
132
51
13
2
0.129
PMT-272
PromoterPDE
48269101 GRCh37
46826602 NCBI36
-13-3269
TATTCAAATACACCTGCAAAGAGAG G → C TAACGAAGGTTTCACAACTAGAGAT
+ 
 
n=
G/G=
G/C=
C/C=
C=
132
64
2
0
0.015
130
65
0
0
0.000
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 30: 3UTRPDE
48200997 GRCh37
46758498 NCBI36
4401 
TTAGATGGTTCTGGGGTTCTAAGGT C → T TTGAGAGCCATCAAGTAGCCTATTC
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
63
5
0
0.037
134
67
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 30: 3UTRPDE
48200944 GRCh37
46758445 NCBI36
4454 
TTATTCAGCATGTAAGTTAAAAGGA G → A AACCACATGATCACTGAATCCCATG
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
68
0
0
0.000
134
67
0
0
0.000
136
65
3
0
0.022
136
68
0
0
0.000
PMT-272
Exon 30: 3UTRPDE
48200841 GRCh37
46758342 NCBI36
4557 
GAAAGTGAGTTTTCCTTAGTTTTAT A → G TTTTACAAAGTCAGTACAGCATTTG
+ 
 
n=
A/A=
A/G=
G/G=
G=
136
66
2
0
0.015
134
54
13
0
0.097
136
68
0
0
0.000
136
58
10
0
0.074
PMT-272
 PDE
48200807 GRCh37
46758308 NCBI36
  
CAAAAAGAAAAGAAACGAAAGGAAG C → T AGAACAAAGAAAGTGAGTTTTCCTT
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
67
1
0
0.007
134
67
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
 PDE
48200732 GRCh37
46758233 NCBI36
  
CAGAGGCTACAGTGAGCTGAGATTG C → A GCCACTGCGCTCCAGCCTGGGCAAC
+ 
 
n=
C/C=
C/A=
A/A=
A=
136
58
9
1
0.081
134
58
8
1
0.075
136
62
6
0
0.044
136
63
4
1
0.044
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.