UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:PRED6
HGNC Symbol:ABCC13
HGNC Description:ATP-binding cassette, sub-family C (CFTR/MRP), member 13, pseudogene
HGNC ID:16022
Superfamily:ABC
Chromosome:Chr.21(+): 15646120-15673707 GRCh37
Location:21q11.2
OMIM:608835
OMIM Phenotype:None
Accessions:AF418600,AY063515
Nucleotide RefSeq:
Protein RefSeq:
Entrez:150000
Ensembl:ENSG00000243064
Isoforms:0
Evidence:Tissue Distribution Evidence: 1 Human fetal liver > ascending colon, fetal spleen - Q-PCR, Yauuchi H et al, Biochemical and Biophysical Research Communications, 2002: 410-417
Tissues:human fetal liver
Type:pseudo
Sets:0
PharmGKB ID:PA134875904
HPRD ID:10586
Substrates:None
Trivial Names:PRED6, C21orf73
Transcripts:NoneENST00000400571 [Chr.21(+): 15646413-15673690 GRCh37]
ENST00000400574 [Chr.21(+): 15646120-15685346 GRCh37]
ENST00000429114 [Chr.21(+): 15608527-15651978 GRCh37]
ENST00000463099 [Chr.21(+): 15646413-15735075 GRCh37]
ENST00000467409 [Chr.21(+): 15646212-15673707 GRCh37]
ENST00000471902 [Chr.21(+): 15646257-15663720 GRCh37]
ENST00000481582 [Chr.21(+): 15646201-15672006 GRCh37]
ENST00000482980 [Chr.21(+): 15646120-15710338 GRCh37]
Annotation History:View Events (16)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for ABCC13.

Variant Data

ABCC13 Resequencing  
Study Name:ABCC13 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDEI
15646060 GRCh37
14567931 NCBI36
n/an/a
AACAGGAAATGGAAAAGGGAGAACT A → G CTGAGTCAAGTGCAAACTCCCAGCC
n/a
 
n=
A/A=
A/G=
G/G=
G=
132
46
18
2
0.167
134
44
20
3
0.194
134
44
16
7
0.224
128
53
10
1
0.094
PMT-272
 PDE
15646190 GRCh37
14568061 NCBI36
n/an/a
TCCACCAGCACCCCGCCCCAGGCGC A → T CTGGCTAGGACTGGAAGGCAAGGAC
n/a
 
n=
A/A=
A/T=
T/T=
T=
130
64
1
0
0.008
134
59
8
0
0.060
134
67
0
0
0.000
128
59
5
0
0.039
PMT-272
 PDE
15646247 GRCh37
14568118 NCBI36
n/an/a
GAAAGCTGACTGCCCGCACCGCCCC A → G GGCGCACTGGGTAGGACTGAAAGGC
n/a
 
n=
A/A=
A/G=
G/G=
G=
130
65
0
0
0.000
134
67
0
0
0.000
134
67
0
0
0.000
128
63
1
0
0.008
PMT-272
 PDE
15646397 GRCh37
14568268 NCBI36
n/an/a
GCAGCCGGGCTCTCAGCCAGCGGCC G → A GGCGCCCCGCGGACCATGCTCTCCA
n/a
 
n=
G/G=
G/A=
A/A=
A=
130
47
17
1
0.146
134
52
15
0
0.112
134
59
8
0
0.060
128
41
19
4
0.211
PMT-272
 PDE
15646405 GRCh37
14568276 NCBI36
n/an/a
GCTCTCAGCCAGCGGCCGGGCGCCC C → A GCGGACCATGCTCTCCAGTACGCAG
n/a
 
n=
C/C=
C/A=
A/A=
A=
130
49
15
1
0.131
134
43
21
3
0.201
134
43
17
7
0.231
128
54
9
1
0.086
PMT-272
 PDE
15646439 GRCh37
14568310 NCBI36
n/an/a
TGCTCTCCAGTACGCAGAACGCGGG C → T GGCTCCTATCAGCGGGTCCGCGGGG
n/a
 
n=
C/C=
C/T=
T/T=
T=
130
64
1
0
0.008
134
62
5
0
0.037
134
67
0
0
0.000
128
62
2
0
0.016
PMT-272

Transmembrane prediction: TOPO2 image is not available.