UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:MRP2
HGNC Symbol:ABCC2
HGNC Description:ATP-binding cassette, sub-family C (CFTR/MRP), member 2
HGNC ID:53
Superfamily:ABC
Chromosome:Chr.10(+): 101542457-101611662 GRCh37
Location:10q24
OMIM:601107
OMIM Phenotype:Dubin-Johnson syndrome
Accessions:U63970
Nucleotide RefSeq:NM_000392
Protein RefSeq:NP_000383
Entrez:1244
Ensembl:ENSG00000023839
Isoforms:2
Evidence:Substrate In Vitro Evidence: 1. MRP2-transfected 2008 human ovarian carcinoma cells are resistant to therapeutic antifolates. Hooijberg, JH et al. Biochem Pharmacol 2003 Mar 1, 65(5):765-71 PMID 12628490. 2. MRP2 cDNA was expressed (on the apical membrane) in polarized MDCK cells. MRP2 transports the organic anions S-(2,4-dinitrophenyl)-glutathione, the glutathione conjugate of ethacrynic acid, and S-(PGA1)-glutathione. MRP2 also transports vinblastine. Evers, R et al. J Clin Invest 1998 Apr 1, 101(7):1310-9 PMID 9525973. 3. MRP2 was isolated from a cisplatin-resistant human head and neck cancer KB cell line. Taniguchi, K et al. Cancer Res 1996 Sep 15, 56(18):4124-9 PMID 8797578. 4. Two MRP2 proteins containing missense mutations identified in patients with Dubin-Johnson syndrome were expressed and function was tested in membrane vesicles. The R768 mutation causes deficient maturation and impaired sorting, and the Q1382R mutation impairs the substrate-induced ATP hydrolysis. Hashimoto, K et al. Hepatology 2002 Nov, 36(5):1236-45 PMID 12395335. Substrate In Vivo Evidence: 1. The transport-deficient (TR-) rat, which is defective in cmoat, display a similar phenotype as Dubin-Johnson patients (i.e. Impaired hepatobiliary transport of non-bile salt organic anions). Paulusma, CC et al. Hepatology 1997 Jun, 25(6):1539-42 PMID 9185779. 2. THE MRP2 inhibitor probenecid increased extracellular brain levels of phenytoin in rats. In TR- rats, extracellular brain levels of phenytoin were significantly higher. Potschka, H et al. JPET 2003 Jul, 306(1):124-31 PMID 12663688. Tissue Distribution Evidence: 1. MRP2 is expressed in liver, small intestine, and kidney. Renes, J et al. Drug Resist Updates 2000, 3:289-302 (review) 2. MRP2 is expressed on the blood-brain barrier. Potschka, H et al. JPET 2003 Jul, 306(1):124-31 PMID 12663688. 3. MRP2 expression measured by RT-PCR was measured in subsets of peripheral blood cells. Expression was highest in CD4+ cells, followed by CD8+>CD56+>CD19+ cells. Oselin, K et al. Eur J Haematol 2003 Aug, 71(2):119-23 PMID 12890151.
Tissues:liver, small intestine, kidney
Type:protein-coding
Sets:I,IV
PharmGKB ID:PA116
HPRD ID:03065
Substrates:glutathione-, glucuronate-, and sulfate-conjugated organic anions
Trivial Names:DJS, MRP2, cMRP, ABC30, CMOAT
Transcripts:NM_000392.3 [Chr.10(+): 101542463-101611662 GRCh37]
XM_005269536.1 [Chr.10(+): 101542457-101611570 GRCh37]
ENST00000370434 [Chr.10(+): 101542520-101557853 GRCh37]
ENST00000370449 [Chr.10(+): 101542489-101611949 GRCh37]
ENST00000496621 [Chr.10(+): 101552046-101554380 GRCh37]
Annotation History:View Events (11)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for ABCC2.

Variant Data

View all PMT variants for ABCC2 on UCSC Genome Browser
Showing SNP features for transcript:   
ABCC2 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:ABCC2 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 PDE
101540955 GRCh37
101530945 NCBI36
-1508-1647
TTGTCATATACCTGTTGGCCATTTA T → C ATGTCTTCTTTGGAAAAGTGTCTGT
+ 
 
n=
T/T=
T/C=
C/C=
C=
200
95
5
0
0.025
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
101541039 GRCh37
101531029 NCBI36
-1424-1563
GTATGTTTGCTATTGAGTTGTATGA G → A TTCCTTATAGTATATTGTGGATATT
+ 
 
n=
G/G=
G/A=
A/A=
A=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE8 pubs
101541053 GRCh37
101531043 NCBI36
-1410-1549
GAGTTGTATGAGTTCCTTATAGTAT A → G TTGTGGATATTAACTCTTCATCAGT
+ 
 
n=
A/A=
A/G=
G/G=
G=
200
23
51
26
0.515
200
21
44
35
0.570
60
1
7
22
0.850
20
0
4
6
0.800
14
1
3
3
0.643
Set-I
 PDEI
101541310 GRCh37
101531300 NCBI36
-1153-1292
AGAATCTCCCACATTCTGGATTTTG A → G CAATTGCATTCCAATGGAGTCCTTT
+ 
 
n=
A/A=
A/G=
G/G=
G=
200
97
3
0
0.015
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
101541363 GRCh37
101531353 NCBI36
-1100-1239
CATGTTCCTGTGTTTCTTATAATCC G → A GTAGTTAGATCTAGAATTTGACCAG
+ 
 
n=
G/G=
G/A=
A/A=
A=
200
94
6
0
0.030
200
99
1
0
0.005
60
30
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
 PDE
101541537 GRCh37
101531527 NCBI36
-926-1065
ACAAAAGGTTGGGTCAGGTGGGGCA C → A GGTAGCTCATGCCTGCAATCCCAGC
+ 
 
n=
C/C=
C/A=
A/A=
A=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
 PDE
101541542 GRCh37
101531532 NCBI36
-921-1060
AGGTTGGGTCAGGTGGGGCACGGTA G → GG CTCATGCCTGCAATCCCAGCCCTTT
+ 
 
n=
G/G=
G/GG=
GG/GG=
GG=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE3 pubs
101541579 GRCh37
101531569 NCBI36
-884-1023
AATCCCAGCCCTTTGGGAGGCCAAG G → A CAGAAGGATTGTTGAAGCCTGGAGT
+ 
 
n=
G/G=
G/A=
A/A=
A=
200
74
25
1
0.135
200
80
19
1
0.105
60
18
8
4
0.267
20
5
4
1
0.300
14
2
4
1
0.429
Set-I
 PDE6 pubs
101541583 GRCh37
101531573 NCBI36
-880-1019
CCAGCCCTTTGGGAGGCCAAGGCAG A → G AGGATTGTTGAAGCCTGGAGTTTGA
ABCC2*2 (-1019A>G) is associated with lower irinotecan clearance and with significant reduction of severe diarrhea in cancer patients. PMID: 19940846.
+ 
 
n=
A/A=
A/G=
G/G=
G=
200
40
47
13
0.365
200
35
44
21
0.430
60
21
8
1
0.167
20
6
4
0
0.200
14
3
3
1
0.357
Set-I
 PDE
101541804 GRCh37
101531794 NCBI36
-659-798
TCTAGCTCAGGCAACAGACCAAGAC C → A CTGTCTCAAAAAACAAAAAACAATA
+ 
 
n=
C/C=
C/A=
A/A=
A=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
101541869 GRCh37
101531859 NCBI36
-594-733
GGTTGGGTCGATGACAGTTTCTAGC G → A ACTGATGCCACCACTCTGTTTACAG
+ 
 
n=
G/G=
G/A=
A/A=
A=
200
100
0
0
0.000
200
100
0
0
0.000
60
29
1
0
0.017
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 1: 5UTRPDE84 pubsIA
101542578 GRCh37
101532568 NCBI36
116-24
ACAATCATATTAATAGAAGAGTCTT C → T GTTCCAGACGCAGTCCAGGAATCAT
Approximately 50% of the variation in ANC nadir in cancer patients is explained by rs3765129, rs2306283 and UGT1A1*93; the AUC of irinotecan, SN-38, SN-38 glucuronide and APC are influenced by rs3740066, rs2306283, rs35605, rs10276036, and rs717620. PMID: 19940846.
+ 
 
n=
C/C=
C/T=
T/T=
T=
200
88
12
0
0.060
200
64
33
3
0.195
60
22
7
1
0.150
20
7
3
0
0.150
14
3
4
0
0.286
Set-I
Exon 1: 5UTRPDE1 pubI
101542579 GRCh37
101532569 NCBI36
117-23
CAATCATATTAATAGAAGAGTCTTC G → A TTCCAGACGCAGTCCAGGAATCATG
+ 
 
n=
G/G=
G/A=
A/A=
A=
200
100
0
0
0.000
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
5
2
0
0.143
Set-I
 PDE
101544357 GRCh37
101534347 NCBI36
  
TGTATGCAACAATCCTTCCCCTTTG G → A TCTCCAGAATTCCTCATTCCTGGAC
+ 
 
n=
G/G=
G/A=
A/A=
A=
200
97
2
1
0.020
200
100
0
0
0.000
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 2: CodingPDEI
101544447 GRCh37
101534437 NCBI36
255116
GTTCTGGTGTGGATTCCCTTGGGCT T → A CCTATGGCTCCTGGCCCCCTGGCAG
+39
Phe → Tyr
(D=22)
n=
T/T=
T/A=
A/A=
A=
200
96
4
0
0.020
200
100
0
0
0.000
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 2: CodingPDE
101544490 GRCh37
101534480 NCBI36
298159
CCTGGCAGCTTCTCCACGTGTATAA A → G TCCAGGACCAAGAGATCCTCTACCA
+53
Lys = Lys
n=
A/A=
A/G=
G/G=
G=
200
98
2
0
0.010
200
98
2
0
0.010
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
101552153 GRCh37
101542143 NCBI36
  
ACCACTTCTGCCCTGTTTACCTTTT C → G ATTACCCATAGGCATCTAGGTGAAA
+ 
 
n=
C/C=
C/G=
G/G=
G=
200
100
0
0
0.000
200
98
2
0
0.010
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
101554150 GRCh37
101544140 NCBI36
  
CCTGTCTCCAATTGGTTTACATTTC G → A ATTTTTTTGTGTCTTTCAGAATCCA
+ 
 
n=
G/G=
G/A=
A/A=
A=
200
94
6
0
0.030
200
100
0
0
0.000
58
29
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
 PDE
101556824 GRCh37
101546814 NCBI36
  
AGATAGCCTCTGACCCAGCCTGGGG G → T TCTCAGCCTGTGGTTCGCTCTTGTT
+ 
 
n=
G/G=
G/T=
T/T=
T=
200
96
4
0
0.020
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 7: CodingPDEA
101556957 GRCh37
101546947 NCBI36
875736
ATTAGTGAGCAAGTTTGAAACGCAC A → C TGAAGAGAGAGCTGCAGAAAGCCAG
+246
Met → Leu
(D=15)
n=
A/A=
A/C=
C/C=
C=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 8: CodingPDE1 pubI
101559094 GRCh37
101549084 NCBI36
1137998
TCATTCCTACTGAAGCTAGTGAATG A → G CATCTTCACGTTTGTGAGTCCTCAG
+333
Asp → Gly
(D=94)
n=
A/A=
A/G=
G/G=
G=
200
98
2
0
0.010
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 9: CodingPDE2 pubsI
101560169 GRCh37
101550159 NCBI36
11971058
TTGCTGATCTCCTTTGCAAGTGACC G → A TGACACATATTTGTGGATTGGATAT
+353
Arg → His
(D=29)
n=
G/G=
G/A=
A/A=
A=
200
94
5
1
0.035
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 10: CodingPDEI
101563785 GRCh37
101553775 NCBI36
13581219
CAATCCTTATCTTTAGGCATTGACC C → T TATCCAACTTGGCCAGGAAGGAGTA
+407
Leu = Leu
n=
C/C=
C/T=
T/T=
T=
196
91
7
0
0.036
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 10: CodingPDE69 pubsIA
101563815 GRCh37
101553805 NCBI36
13881249
CAACTTGGCCAGGAAGGAGTACACC G → A TTGGAGAAACAGTGAACCTGATGTC
+417
Val → Ile
(D=29)
n=
G/G=
G/A=
A/A=
A=
200
69
28
3
0.170
200
68
30
2
0.170
60
24
5
1
0.117
20
7
3
0
0.150
14
7
0
0
0.000
Set-I
Exon 10: CodingPDEI
101564000 GRCh37
101553990 NCBI36
15731434
TGGTGCTTGTAATCCCAATTAATGC G → T ATACTGTCCACCAAGAGTAAGACCA
+478
Ala = Ala
n=
G/G=
G/T=
T/T=
T=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 10: CodingPDE1 pub
101564023 GRCh37
101554013 NCBI36
15961457
GCGATACTGTCCACCAAGAGTAAGA C → T CATTCAGGTAAAGAAAAAGTCACCC
+486
Thr → Ile
(D=89)
n=
C/C=
C/T=
T/T=
T=
200
100
0
0
0.000
200
100
0
0
0.000
60
29
1
0
0.017
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
101565114 GRCh37
101555104 NCBI36
  
CCTCTCTCATGGAAGCGTATATTGT T → G TTTCTTTTGCTTTTTTCCTGGCAGG
+ 
 
n=
T/T=
T/G=
G/G=
G=
196
97
1
0
0.005
198
99
0
0
0.000
50
25
0
0
0.000
18
9
0
0
0.000
12
5
1
0
0.083
Set-I
Exon 11: CodingPDE
101565157 GRCh37
101555147 NCBI36
16221483
CTGGCAGGTCAAAAATATGAAGAAT A → G AAGACAAACGTTTAAAGATCATGAA
+495
Lys → Glu
(D=56)
n=
A/A=
A/G=
G/G=
G=
198
99
0
0
0.000
198
98
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 13: CodingPDE
101567857 GRCh37
101557847 NCBI36
18251686
CTTTCCAGGTATCTGTGGTCACATT T → G TCTGTTTATGTCCTGGTGGATAGCA
+562
Phe → Leu
(D=22)
n=
T/T=
T/G=
G/G=
G=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
101568013 GRCh37
101558003 NCBI36
  
TAGGTCGGCATTCTCACTGCTAACT C → G CCTGTCTCTGGTTAAAAGCCTTGGA
+ 
 
n=
C/C=
C/G=
G/G=
G=
200
82
17
1
0.095
200
100
0
0
0.000
60
30
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
 PDE
101569997 GRCh37
101559987 NCBI36
  
TTTGGTAAATAAATTTGGAAGTTGC T → C TCCCAAACTTATTCGCAGTACTGGT
+ 
 
n=
T/T=
T/C=
C/C=
C=
200
95
5
0
0.025
200
95
5
0
0.025
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 16: CodingPDE1 pub
101572816 GRCh37
101562806 NCBI36
21482009
ATGGCAGGCCAACTTGTGGCTGTGA T → C AGGCCCTGTCGGCTCTGGGAAATCC
+670
Ile → Thr
(D=89)
n=
T/T=
T/C=
C/C=
C=
200
97
3
0
0.015
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 16: CodingPDE
101572880 GRCh37
101562870 NCBI36
22122073
CCATGCTGGGAGAAATGGAAAATGT C → A CACGGGCACATCACCATCAAGGTGA
+691
Val = Val
n=
C/C=
C/A=
A/A=
A=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDEI
101577277 GRCh37
101567267 NCBI36
  
TAACAAGGGATCTTCAAGGGTGAAG G → T CATATTGAAGAGAAAAAGTGAGGAT
+ 
 
n=
G/G=
G/T=
T/T=
T=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 19: CodingPDE
101578952 GRCh37
101568942 NCBI36
26852546
GAGAAAGGATCCTACAGTGCTCTCC T → G GGCCAAAAAAGGAGAGTTTGCTAAG
+849
Leu → Arg
(D=102)
n=
T/T=
T/G=
G/G=
G=
194
96
1
0
0.005
200
98
2
0
0.010
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
101590219 GRCh37
101580209 NCBI36
  
GGCTATCTATTCAGCTGGCAGCCCT C → A GTCAGCTCTATATTTCCACTTGATC
+ 
 
n=
C/C=
C/A=
A/A=
A=
184
92
0
0
0.000
184
92
0
0
0.000
50
24
1
0
0.020
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
101590382 GRCh37
101580372 NCBI36
  
TCCCCTGGTCATCTGCCCTGAAATG C → T GCTTTGATGCCAGCTGAGTGACTGT
+ 
 
n=
C/C=
C/T=
T/T=
T=
198
97
2
0
0.010
200
100
0
0
0.000
56
28
0
0
0.000
18
9
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
101590460 GRCh37
101580450 NCBI36
  
GAATTGCCTGCATGCTCAGGGAAGC T → G TCCCTCTCTCAGTTCTAGGTCCAAT
+ 
 
n=
T/T=
T/G=
G/G=
G=
196
97
1
0
0.005
196
98
0
0
0.000
56
28
0
0
0.000
18
9
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 22: CodingPDEI
101591385 GRCh37
101581375 NCBI36
30402901
CTTTGCAGGTGAAGTTCTCCATCTA C → A CTGGAGTACCTACAAGCAATAGGAT
+967
Tyr → STOP
n=
C/C=
C/A=
A/A=
A=
200
99
1
0
0.005
198
99
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 22: CodingPDE1 pubI
101591418 GRCh37
101581408 NCBI36
30732934
ACCTACAAGCAATAGGATTGTTTTC G → A ATATTCTTCATCATCCTTGCGTTTG
+978
Ser = Ser
n=
G/G=
G/A=
A/A=
A=
200
100
0
0
0.000
198
99
0
0
0.000
60
26
4
0
0.067
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 22: CodingPDE
101591428 GRCh37
101581418 NCBI36
30832944
AATAGGATTGTTTTCGATATTCTTC A → G TCATCCTTGCGTTTGTGATGAATTC
+982
Ile → Val
(D=29)
n=
A/A=
A/G=
G/G=
G=
200
99
1
0
0.005
198
99
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 23: CodingPDE
101591737 GRCh37
101581727 NCBI36
32463107
ACAAAACTGCTTCCATCTCTAGGTA T → C ATTTGTGTTCATAGCACATTTCTGG
+1036
Ile → Thr
(D=89)
n=
T/T=
T/C=
C/C=
C=
200
99
1
0
0.005
198
98
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 23: CodingPDE
101591818 GRCh37
101581808 NCBI36
33273188
ATCTTGCACAAGCAACTGCTGAACA A → G TATCCTTCGAGCACCTATGAGATTT
+1063
Asn → Ser
(D=46)
n=
A/A=
A/G=
G/G=
G=
200
99
1
0
0.005
198
99
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 24: CodingPDE
101594274 GRCh37
101584264 NCBI36
35353396
CCATCATCGTCATTCCTCTTGGCAT T → C ATTTATGTATCTGTTCAGGTAGGTT
+1132
Ile = Ile
n=
T/T=
T/C=
C/C=
C=
200
100
0
0
0.000
200
98
2
0
0.010
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
101595815 GRCh37
101585805 NCBI36
  
AAGATGGTGGATGCCTCATGACTGC G → A GGACTGGCTGATTCTTTACTTTTTG
+ 
 
n=
G/G=
G/A=
A/A=
A=
200
100
0
0
0.000
200
98
2
0
0.010
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 25: CodingPDE2 pubsI
101595975 GRCh37
101585965 NCBI36
36813542
ATCCGTGCCTTTGAGCACCAGCAGC G → T ATTTCTGAAACACAATGAGGTGAGG
+1181
Arg → Leu
(D=102)
n=
G/G=
G/T=
T/T=
T=
200
83
17
0
0.085
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 25: CodingPDE1 pub
101595994 GRCh37
101585984 NCBI36
37003561
AGCAGCGATTTCTGAAACACAATGA G → A GTGAGGATTGACACCAACCAGAAAT
+1187
Glu = Glu
n=
G/G=
G/A=
A/A=
A=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 25: CodingPDE13 pubsI
101595996 GRCh37
101585986 NCBI36
37023563
CAGCGATTTCTGAAACACAATGAGG T → A GAGGATTGACACCAACCAGAAATGT
+1188
Val → Glu
(D=121)
n=
T/T=
T/A=
A/A=
A=
200
88
11
1
0.065
200
86
13
1
0.075
60
30
0
0
0.000
20
10
0
0
0.000
14
6
1
0
0.071
Set-I
 PDE
101596053 GRCh37
101586043 NCBI36
  
TCCTGGATCACCTCCAACAGGTGAG G → C CTTCCCCTGGGTATTTACCCATGTG
+ 
 
n=
G/G=
G/C=
C/C=
C=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
101601704 GRCh37
101591694 NCBI36
  
GGACGTGATCAGTGACACGCACTCT C → T TGGTTCTGTTGCCCCACAGGTGGCT
+ 
 
n=
C/C=
C/T=
T/T=
T=
200
99
1
0
0.005
198
97
2
0
0.010
60
30
0
0
0.000
20
10
0
0
0.000
12
6
0
0
0.000
Set-I
 PDE
101601880 GRCh37
101591870 NCBI36
  
GTTTGAAGGTTGGGAGTTTGGTTTC G → A TTAGTGTGCTTATTCTTAAATTAAG
+ 
 
n=
G/G=
G/A=
A/A=
A=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDEA
101603522 GRCh37
101593512 NCBI36
  
GAGTGGTTGAGTTGGTTTCTGTGCC T → C ATGATGATTTTCAGTCTTCTGGTTT
+ 
 
n=
T/T=
T/C=
C/C=
C=
200
54
42
4
0.250
194
65
31
1
0.170
56
27
1
0
0.018
20
9
1
0
0.050
14
6
1
0
0.071
Set-I
Exon 27: CodingPDEA
101603631 GRCh37
101593621 NCBI36
39563817
CAACATTGTGGCTGTTGAGCGAATA A → G CTGAGTACACAAAAGTGGAAAATGA
+1273
Thr → Ala
(D=58)
n=
A/A=
A/G=
G/G=
G=
200
98
2
0
0.010
198
99
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 28: CodingPDE1 pub
101604107 GRCh37
101594097 NCBI36
40113872
CCCTGGGTGACTGATAAGAGGCCTC C → T GCCAGATTGGCCCAGCAAAGGCAAG
+1291
Pro → Leu
(D=98)
n=
C/C=
C/T=
T/T=
T=
194
93
4
0
0.021
196
97
1
0
0.005
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 28: CodingPDE51 pubs
101604207 GRCh37
101594197 NCBI36
41113972
TCCTCAGAGGGATCACTTGTGACAT C → T GGTAGCATGGAGAAGGTAGGTGGAG
Approximately 50% of the variation in ANC nadir in cancer patients is explained by rs3765129, rs2306283 and UGT1A1*93; the AUC of irinotecan, SN-38, SN-38 glucuronide and APC are influenced by rs3740066, rs2306283, rs35605, rs10276036, and rs717620. PMID: 19940846.
+1324
Ile = Ile
n=
C/C=
C/T=
T/T=
T=
194
51
39
7
0.273
196
40
41
17
0.383
58
18
11
0
0.190
20
5
5
0
0.250
14
2
5
0
0.357
Set-I
 PDE
101604243 GRCh37
101594233 NCBI36
  
AGAAGGTAGGTGGAGTGAAGGAAGG C → T CTGGATGGGAGGCCTTGTGATCAAA
+ 
 
n=
C/C=
C/T=
T/T=
T=
180
90
0
0
0.000
188
91
3
0
0.016
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 29: CodingPDE
101605455 GRCh37
101595445 NCBI36
42014062
GCCTCTTCAGAATCTTAGAGGCTGC C → T GGTGGTCAGATTATCATTGATGGAG
+1354
Ala = Ala
n=
C/C=
C/T=
T/T=
T=
200
94
6
0
0.030
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 29: CodingPDEIA
101605503 GRCh37
101595493 NCBI36
42494110
GAGTAGATATTGCTTCCATTGGGCT C → T CACGACCTCCGAGAGAAGCTGACCA
+1370
Leu = Leu
n=
C/C=
C/T=
T/T=
T=
200
84
14
2
0.090
200
100
0
0
0.000
60
30
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
 PDEA
101605550 GRCh37
101595540 NCBI36
  
ACCATCATCCCCCAGGTGAGCTCTA G → C AACTTACTCGGGCACATGCCGTGGG
+ 
 
n=
G/G=
G/C=
C/C=
C=
200
88
11
1
0.065
200
86
13
1
0.075
60
30
0
0
0.000
20
10
0
0
0.000
14
6
1
0
0.071
Set-I
 PDEI
101606683 GRCh37
101596673 NCBI36
  
GAACTCCGAGGTCCTTTTCTGGCAT G → A AGCCCCAACAGCCCCCTTGTCCTTT
+ 
 
n=
G/G=
G/A=
A/A=
A=
188
69
23
2
0.144
184
87
5
0
0.027
60
29
1
0
0.017
20
6
4
0
0.200
14
7
0
0
0.000
Set-I
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 30: CodingPDE1 pubI
101606813 GRCh37
101596803 NCBI36
43814242
TTTGGAAGGCCTTGGAGCTGGCTCA C → T CTCAAGTCTTTTGTGGCCAGCCTGC
+1414
His = His
n=
C/C=
C/T=
T/T=
T=
192
95
1
0
0.005
190
95
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 30: CodingPDEI
101606861 GRCh37
101596851 NCBI36
44294290
TGCAACTTGGGTTATCCCACGAAGT G → T ACAGAGGCTGGTGGCAACCTGAGGT
+1430
Val = Val
n=
G/G=
G/T=
T/T=
T=
192
82
13
1
0.078
190
82
12
1
0.074
60
30
0
0
0.000
20
10
0
0
0.000
14
6
1
0
0.071
Set-I
 PDE
101606895 GRCh37
101596885 NCBI36
  
TGGTGGCAACCTGAGGTAATGTTCC A → C TAGCCTGCTACCCCTGCAGGCAATG
+ 
 
n=
A/A=
A/C=
C/C=
C=
192
95
1
0
0.005
190
95
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 31: CodingPDEI
101610455 GRCh37
101600445 NCBI36
45494410
AGGCCACTGCTGCGGTGGATCTAGA G → A ACAGACAACCTCATTCAGACGACCA
+1470
Glu = Glu
n=
G/G=
G/A=
A/A=
A=
198
72
25
2
0.146
200
93
7
0
0.035
60
29
1
0
0.017
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
Exon 31: CodingPDE2 pubsI
101610533 GRCh37
101600523 NCBI36
46274488
TGATCACCATCGCCCACAGGCTGCA C → T ACCATCATGGACAGTGACAAGTGAG
+1496
His = His
n=
C/C=
C/T=
T/T=
T=
198
92
7
0
0.035
200
88
12
0
0.060
60
29
1
0
0.017
20
10
0
0
0.000
14
6
1
0
0.071
Set-I
 PDE
101610565 GRCh37
101600555 NCBI36
  
ATGGACAGTGACAAGTGAGTGTAGG G → A GGACAGGGCTTGACACGGATGGCTT
+ 
 
n=
G/G=
G/A=
A/A=
A=
198
86
12
1
0.071
200
86
14
0
0.070
60
29
1
0
0.017
20
10
0
0
0.000
14
6
1
0
0.071
Set-I
Exon 32: CodingPDEI
101611277 GRCh37
101601267 NCBI36
46664527
GTTTCAGGGTAATGGTCCTAGACAA C → T GGGAAGATTATAGAGTGCGGCAGCC
+1509
Asn = Asn
n=
C/C=
C/T=
T/T=
T=
194
96
1
0
0.005
198
97
2
0
0.010
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 32: CodingPDE19 pubsI
101611294 GRCh37
101601284 NCBI36
46834544
CTAGACAACGGGAAGATTATAGAGT G → A CGGCAGCCCTGAAGAACTGCTACAA
+1515
Cys → Tyr
(D=194)
n=
G/G=
G/A=
A/A=
A=
194
63
30
4
0.196
198
84
14
1
0.081
58
29
0
0
0.000
20
9
1
0
0.050
14
6
1
0
0.071
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.