UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:MRP5
HGNC Symbol:ABCC5
HGNC Description:ATP-binding cassette, sub-family C (CFTR/MRP), member 5
HGNC ID:56
Superfamily:ABC
Chromosome:Chr.3(-): 183637722-183735803 GRCh37
Location:3q27
OMIM:605251
OMIM Phenotype:None
Accessions:AF104942
Nucleotide RefSeq:NM_005688
Protein RefSeq:NP_005679
Entrez:10057
Ensembl:ENSG00000114770
Isoforms:7
Evidence:Substrate In Vitro Evidence: 1. MRP5 retrovirus-overproducing HEK293 and MDCKII cells were generated. Cytotoxicity assays using HEK293 cells showed that MRP5 caused resistance to 6-mercaptopurine, its prodrug azathioprine, thioguanine, 5-HP, and PMEA, but not to etoposide or teniposide. Wijnholds, J et al. PNAS 2000 Jun 20, 97(13):7476-81. 2. MRP5 is a GS-X pump because it transports DNP-GS and is inhibited by typical OAT inhibitors such as sulfinpyrazone. Wijnholds, J et al. PNAS 2000 Jun 20, 97(13):7476-81. 3. MRP5 expressed in inside-out membrane vesicles was used to test transport of cGMP and camp. Data indicate that MRP5 is a low-affinity cyclic nucleotide transporter that may function as an overflow pump. Wielinga, PR et al. JBC 2003 May 16, 278(20):17664-71 PMID 12637526. 4. Inside-out vesicles derived from MRP5-overexpressing cells accumulated alaninyl-d4TMP. Based on inhibitor screening, the affinity of MRP5 for nucleotide-based substrates is low. Reid, G et al. Mol Pharm 2003 May, 63(5):1094-103 PMID 12695538. Substrate In Vivo Evidence: 1. MRP5 expression in matched normal lung and lung cancer biopsies was examined by RT-PCR. Results suggest that exposure to platinum drugs in lung cancer and/or the chronic stress response to xenobiotics increased MRP5 expression levels. Oguri, T et al. Int J Cancer 2000 Apr 1, 86(1):95-100 PMID 10728601. 2. MRP5 knockout mice are healthy and fertile. Wijnholds, J et al. PNAS 2000 Jun 20, 97(13):7476-81. Tissue Distribution Evidence: 1. EST database screening demonstrates MRP5 expression in almost every tissue tested. MRP5 is overexpressed in a few cell lines, and RNA levels don't correlate with doxorubicin or cisplatin resistance. Kool, M et al. Cancer Res 1997 Aug 15, 57(16):3537-47 PMID 9270026. 2. In polarized MDCKII/MRP5 cells, MRP5 is localized to the basolateral plasma membranes. In non-polarized HEK293/MRP5 cells, MRP5 was predominantly intracellular with some membrane staining. Wijnholds, J et al. PNAS 2000 Jun 20, 97(13):7476-81. 3. MRP5 is localized in cardiac and cardiovascular myocytes as well as endothelial cells with increased expression in ischemic cardiomyopathy. MRP5-mediated cellular export my be a novel, disease-dependent pathway for cGMP removal from cardiac cells. Dazert, P et al. Am J Path 2003 Oct, 163(4):1567-77 PMID 14507663.
Tissues:ubiquitous, increased expression in cardiac tissue in ischemic cardiomyopathy
Type:protein-coding
Sets:II,IV
PharmGKB ID:PA395
HPRD ID:06898
Substrates:6-MP, PMEA, low affinity for cyclic nucleotides
Trivial Names:MRP5, SMRP, ABC33, MOATC, MOAT-C, pABC11, EST277145
Transcripts:NM_001023587.1 [Chr.3(-): 183701541-183735727 GRCh37]
NM_005688.2 [Chr.3(-): 183637722-183735727 GRCh37]
XM_005247059.1 [Chr.3(-): 183637722-183735289 GRCh37]
XM_005247060.1 [Chr.3(-): 183637722-183733559 GRCh37]
XM_005247062.1 [Chr.3(-): 183637722-183733559 GRCh37]
XM_005247058.1 [Chr.3(-): 183637722-183733488 GRCh37]
XM_005247061.1 [Chr.3(-): 183645246-183735803 GRCh37]
ENST00000265586 [Chr.3(-): 183639002-183732192 GRCh37]
ENST00000334444 [Chr.3(-): 183637722-183735803 GRCh37]
ENST00000382494 [Chr.3(-): 183701541-183735677 GRCh37]
ENST00000392579 [Chr.3(-): 183701541-183735677 GRCh37]
ENST00000427120 [Chr.3(-): 183701541-183735651 GRCh37]
ENST00000437205 [Chr.3(-): 183637727-183735624 GRCh37]
ENST00000437341 [Chr.3(-): 183706361-183735232 GRCh37]
ENST00000438979 [Chr.3(-): 183705559-183735704 GRCh37]
ENST00000443376 [Chr.3(-): 183701541-183735677 GRCh37]
ENST00000443497 [Chr.3(-): 183643448-183660568 GRCh37]
ENST00000446941 [Chr.3(-): 183718451-183735727 GRCh37]
ENST00000476402 [Chr.3(-): 183685092-183689619 GRCh37]
ENST00000492216 [Chr.3(-): 183695306-183701364 GRCh37]
Annotation History:View Events (44)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for ABCC5.

Variant Data

View all PMT variants for ABCC5 on UCSC Genome Browser
Showing SNP features for transcript:   
ABCC5 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:ABCC5 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 PDE
183736221 GRCh37
185218915 NCBI36
-494-4041
CATTTTATTATCTAGAGACCAGGCA G → A CGAGACATTGATGGGCAGTTGGTGT
- 
 
n=
G/G=
G/A=
A/A=
A=
134
64
3
0
0.022
136
68
0
0
0.000
132
66
0
0
0.000
132
64
2
0
0.015
n/a
0.000
PMT-272
 PDE
183736180 GRCh37
185218874 NCBI36
-453-4000
CAGTTGGTGTTAAAGTGAGAAAGGC G → A GTATCTGCGCAGACTGCAGGGTCGA
- 
 
n=
G/G=
G/A=
A/A=
A=
134
67
0
0
0.000
136
68
0
0
0.000
132
62
4
0
0.030
132
66
0
0
0.000
n/a
0.000
PMT-272
 PDE
183736094 GRCh37
185218788 NCBI36
-367-3914
AAGAACTGGGGCTGGCCGGCCTGAC G → C ACTCTCAACGGGTTAGACGCGGGCT
- 
 
n=
G/G=
G/C=
C/C=
C=
134
64
3
0
0.022
136
68
0
0
0.000
132
66
0
0
0.000
132
64
2
0
0.015
n/a
0.000
PMT-272
 PDE
183736090 GRCh37
185218784 NCBI36
-363-3910
ACTGGGGCTGGCCGGCCTGACGACT C → G TCAACGGGTTAGACGCGGGCTACGA
- 
 
n=
C/C=
C/G=
G/G=
G=
134
66
1
0
0.007
136
68
0
0
0.000
132
66
0
0
0.000
132
66
0
0
0.000
n/a
0.000
PMT-272
 PDE
183735982 GRCh37
185218676 NCBI36
-255-3802
CTACGAACAGCACTGTGTGCGAACA C → T AGGGCCACGGTTAAGCCTCCCGGCT
- 
 
n=
C/C=
C/T=
T/T=
T=
134
67
0
0
0.000
136
67
1
0
0.007
132
66
0
0
0.000
132
66
0
0
0.000
n/a
0.000
PMT-272
PromoterPDE1 pub
183735909 GRCh37
185218603 NCBI36
-182-3729
CCTGAGAAGATTCCAGACAGTCTCG C → T AGAGGCACGGGGAAGGATGGAACAG
- 
 
n=
C/C=
C/T=
T/T=
T=
134
67
0
0
0.000
136
67
1
0
0.007
132
66
0
0
0.000
132
64
2
0
0.015
n/a
0.000
PMT-272
PromoterPDE
183735890 GRCh37
185218584 NCBI36
-163-3710
GTCTCGCAGAGGCACGGGGAAGGAT G → A GAACAGAGCCGGGAGCTCGGTGGGA
- 
 
n=
G/G=
G/A=
A/A=
A=
134
67
0
0
0.000
136
68
0
0
0.000
132
65
1
0
0.008
132
66
0
0
0.000
n/a
0.000
PMT-272
PromoterPDE
183735854 GRCh37
185218548 NCBI36
-127-3674
GGGAGCTCGGTGGGAAGAGGGGCAG C → T CCGCACCGCCCCCGGGATGTCACCG
- 
 
n=
C/C=
C/T=
T/T=
T=
134
59
8
0
0.060
136
68
0
0
0.000
132
66
0
0
0.000
132
64
2
0
0.015
n/a
0.000
PMT-272
PromoterPDE
183735851 GRCh37
185218545 NCBI36
-124-3671
AGCTCGGTGGGAAGAGGGGCAGCCC G → C CACCGCCCCCGGGATGTCACCGGCG
- 
 
n=
G/G=
G/C=
C/C=
C=
134
65
2
0
0.015
136
68
0
0
0.000
132
66
0
0
0.000
132
66
0
0
0.000
n/a
0.000
PMT-272
PromoterPDE
183735837 GRCh37
185218531 NCBI36
-110-3657
AGGGGCAGCCCGCACCGCCCCCGGG A → G TGTCACCGGCGCTTCTGGGAAATGT
- 
 
n=
A/A=
A/G=
G/G=
G=
134
66
1
0
0.007
136
68
0
0
0.000
132
66
0
0
0.000
132
66
0
0
0.000
n/a
0.000
PMT-272
PromoterPDE
183735792 GRCh37
185218486 NCBI36
-65-3612
AAATGTAGTCCTTCGCCGCGTCCGC A → C GCCCTGGGCACTCGGAAGGAGGACT
- 
 
n=
A/A=
A/C=
C/C=
C=
134
67
0
0
0.000
136
68
0
0
0.000
132
63
3
0
0.023
132
66
0
0
0.000
n/a
0.000
PMT-272
PromoterPDE
183735736 GRCh37
185218430 NCBI36
-9-3556
TCCCTTCAGCCTTGGGAATGCTTTG T → C GCAGCGCGCTTGCGCGGTGTGGCGG
- 
 
n=
T/T=
T/C=
C/C=
C=
134
67
0
0
0.000
136
68
0
0
0.000
132
65
1
0
0.008
132
66
0
0
0.000
n/a
0.000
PMT-272
Exon 1: 5UTR
Promoter
PDE
183735708 GRCh37
185218402 NCBI36
20-3528
AGCGCGCTTGCGCGGTGTGGCGGCC G → A ATGCCGCTATAAAGGCTTGTTTTGC
- 
 
n=
G/G=
G/A=
A/A=
A=
134
67
0
0
0.000
136
68
0
0
0.000
132
65
1
0
0.008
132
66
0
0
0.000
n/a
0.000
PMT-272
Exon 1: 5UTRPDE
183735667 GRCh37
185218361 NCBI36
61-3487
CTTGTTTTGCTGCAGGGCTCATGCT C → T GGGAGCGTGGTTGAGCGGCTGGCGC
- 
 
n=
C/C=
C/T=
T/T=
T=
134
66
1
0
0.007
136
68
0
0
0.000
132
66
0
0
0.000
132
66
0
0
0.000
n/a
0.000
PMT-272
Exon 1: 5UTRPDE1 pub
183735644 GRCh37
185218338 NCBI36
84-3464
CTCGGGAGCGTGGTTGAGCGGCTGG C → T GCGGTTGTCCTGGAGCAGGGGCGCA
- 
 
n=
C/C=
C/T=
T/T=
T=
134
67
0
0
0.000
136
63
5
0
0.037
132
66
0
0
0.000
132
62
4
0
0.030
n/a
0.000
PMT-272
 PDE
183735561 GRCh37
185218255 NCBI36
 -3381
TCCAGCTCGGTTGTCACGGGGATCA C → A CCCTTTGCATTTCCTCGGGGCGTGG
- 
 
n=
C/C=
C/A=
A/A=
A=
134
67
0
0
0.000
136
67
1
0
0.007
132
66
0
0
0.000
132
66
0
0
0.000
n/a
0.000
PMT-272
Exon 2: 5UTRPDE
183732209 GRCh37
185214903 NCBI36
137-29
AATTCTGATGTGAAACTAACAGTCT G → A TGAGCCCTGGAACCTCCACTCAGAG
- 
 
n=
G/G=
G/A=
A/A=
A=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
 PDE
183707231 GRCh37
185189925 NCBI36
  
CAGTTTGAGCTGTTTCATCAGTTCC G → A TTTGCCTCTCGCCTGTGTATTAACT
- 
 
n=
G/G=
G/A=
A/A=
A=
160
80
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
183706558 GRCh37
185189252 NCBI36
  
TCCATTAAACACGGGCTGCCCTCTC C → A GTGCGTGTTGATAGCTTTGTGATTT
- 
 
n=
C/C=
C/A=
A/A=
A=
160
80
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 4: CodingPDE
183706368 GRCh37
185189062 NCBI36
600435
CCAAGCACGAGTCTTCTGACGTGAA C → T TGCAGAAGGTAGGCGCCTCTGGTCC
-145
Asn = Asn
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
160
79
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 4: CodingPDE
183706364 GRCh37
185189058 NCBI36
604439
GCACGAGTCTTCTGACGTGAACTGC A → G GAAGGTAGGCGCCTCTGGTCCACCC
-147
Arg → Gly
(D=125)
n=
A/A=
A/G=
G/G=
G=
160
80
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
183706329 GRCh37
185189023 NCBI36
  
CGCCTCTGGTCCACCCTCATCTCCC C → A CATGCCGGGTGGGCAGGGCCTGAGC
- 
 
n=
C/C=
C/A=
A/A=
A=
160
80
0
0
0.000
160
79
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
183705477 GRCh37
185188171 NCBI36
  
TAACACTCTTATTCTGTTGCAGAGG T → C TGTGCTCAGCTTTGGGCTAGGTAGC
- 
 
n=
T/T=
T/C=
C/C=
C=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
183700552 GRCh37
185183246 NCBI36
  
GAAATCCCTGGGTGAGGTGAGTGAG G → A GGTGTTTGCTTCACAGCAGAGAGCA
- 
 
n=
G/G=
G/A=
A/A=
A=
160
70
10
0
0.063
160
80
0
0
0.000
120
60
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
 PDE1 pubI
183700211 GRCh37
185182905 NCBI36
  
GAGTAAGCCTCCCAGCTGAATCCTG G → A CAGCTTCTCCTTAGGAGATGAGTTA
- 
 
n=
G/G=
G/A=
A/A=
A=
160
15
44
21
0.537
160
32
39
9
0.356
120
20
28
12
0.433
100
27
18
5
0.280
12
5
1
0
0.083
Set-II
Exon 8: CodingPDE1 pubI
183699516 GRCh37
185182210 NCBI36
13111146
TCAAAGCATTTTCTCAGAGTGTTCA A → G AGTGAGTTTAAAGATTTTGTATGTG
-382
Gln = Gln
n=
A/A=
A/G=
G/G=
G=
160
42
31
7
0.281
160
31
39
10
0.369
120
20
28
12
0.433
100
27
20
3
0.260
12
5
1
0
0.083
Set-II
 PDE
183699454 GRCh37
185182148 NCBI36
  
AGGACCTTGGATTCTTTGGGTCTTA T → A AATTCACACACTTTGCTTTCTGAGC
- 
 
n=
T/T=
T/A=
A/A=
A=
160
80
0
0
0.000
160
79
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 9: CodingPDE1 pubI
183696402 GRCh37
185179096 NCBI36
13501185
AGGAGCGTCGGATATTGGAAAAAGC T → C GGGTACTTCCAGAGCATCACTGTGG
-395
Ala = Ala
n=
T/T=
T/C=
C/C=
C=
160
6
38
36
0.688
160
17
32
31
0.588
120
2
8
50
0.900
100
12
27
11
0.490
12
0
2
4
0.833
Set-II
Exon 9: CodingPDEI
183696387 GRCh37
185179081 NCBI36
13651200
TGGAAAAAGCTGGGTACTTCCAGAG C → T ATCACTGTGGGTGTGGCTCCCATTG
-400
Ser = Ser
n=
C/C=
C/T=
T/T=
T=
160
49
22
9
0.250
160
80
0
0
0.000
120
60
0
0
0.000
100
48
2
0
0.020
12
6
0
0
0.000
Set-II
 PDE
183696281 GRCh37
185178975 NCBI36
  
TCTGACAGCAGCACAGGTCAGGGAA C → T CCTCAGGGATGGGGAACATTTTAGA
- 
 
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
160
79
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDEI
183696115 GRCh37
185178809 NCBI36
  
CATCTCAAAACAAAACAAACAAACA A → G ACAAAAAAAAAATACCACATATGGA
- 
 
n=
A/A=
A/G=
G/G=
G=
160
58
19
3
0.156
160
47
29
4
0.231
120
18
28
14
0.467
100
32
16
2
0.200
12
1
1
4
0.750
Set-II
 PDEI
183695237 GRCh37
185177931 NCBI36
  
CACACAACTAACTGCTGGCTCTGTT C → T AAGGGGCCACCCAGGCTGGCCTCAC
- 
 
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 11: CodingPDEI
183689610 GRCh37
185172304 NCBI36
16671502
AAAAATGCCACCTTGGCATGGGACT C → A CTCCCACTCCAGTATCCAGAACTCG
-501
Ser → Tyr
(D=144)
n=
C/C=
C/A=
A/A=
A=
160
80
0
0
0.000
160
79
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
183689340 GRCh37
185172034 NCBI36
  
CTGGAGATCCAAGAGGTAAGTGGTC C → T GCCCCCTGCCTCCCTGCCCGCACCC
- 
 
n=
C/C=
C/T=
T/T=
T=
160
74
5
1
0.044
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
183685597 GRCh37
185168291 NCBI36
  
CCTCAAGTCCTTAGCGATGAGTGGT T → C AGTAGTCTCTAAATGACCCTCCTCT
- 
 
n=
T/T=
T/C=
C/C=
C=
160
66
14
0
0.087
160
79
1
0
0.006
120
60
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
 PDE
183685580 GRCh37
185168274 NCBI36
  
TGAGTGGTTAGTAGTCTCTAAATGA C → G CCTCCTCTCTGTGTGCCTTGTCCAG
- 
 
n=
C/C=
C/G=
G/G=
G=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 12: CodingPDE2 pubsI
183685534 GRCh37
185168228 NCBI36
19471782
TCCAGGGTAAACTGGTTGGAATCTG T → C GGCAGTGTGGGAAGTGGAAAAACCT
-594
Cys = Cys
n=
T/T=
T/C=
C/C=
C=
160
2
36
42
0.750
160
17
32
31
0.588
120
2
7
51
0.908
100
12
27
11
0.490
12
0
2
4
0.833
Set-II
 PDE
183683369 GRCh37
185166063 NCBI36
  
CGGGAAATTACCAGAGCTAGATTCC A → G TTGTGGAAGGTGGGGGTTCCGTTGG
- 
 
n=
A/A=
A/G=
G/G=
G=
160
77
3
0
0.019
160
80
0
0
0.000
120
60
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
 PDEI
183683145 GRCh37
185165839 NCBI36
  
AGAAAGGCAAGGAATGTTTGGCTTC T → C GTCATGCTTTCCATCTTGGCCGCGT
- 
 
n=
T/T=
T/C=
C/C=
C=
160
79
1
0
0.006
160
80
0
0
0.000
120
54
5
1
0.058
100
50
0
0
0.000
12
5
1
0
0.083
Set-II
 PDE
183683124 GRCh37
185165818 NCBI36
  
CTTCTGTCATGCTTTCCATCTTGGC C → T GCGTGAGATGCAAGGCAGCCCTAGT
- 
 
n=
C/C=
C/T=
T/T=
T=
160
78
2
0
0.013
160
63
16
1
0.113
120
60
0
0
0.000
100
46
4
0
0.040
12
6
0
0
0.000
Set-II
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 PDE
183683122 GRCh37
185165816 NCBI36
  
TCTGTCATGCTTTCCATCTTGGCCG C → T GTGAGATGCAAGGCAGCCCTAGTCA
- 
 
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
5
1
0
0.083
Set-II
 PDE
183682960 GRCh37
185165654 NCBI36
  
CGACCTGACGGAGGTACAGGCCTTC C → T GCCCCTGACCAGGCATTTAGCAGAG
- 
 
n=
C/C=
C/T=
T/T=
T=
160
78
2
0
0.013
160
73
7
0
0.044
120
38
18
4
0.217
100
49
1
0
0.010
12
5
1
0
0.083
Set-II
 PDE1 pubI
183682897 GRCh37
185165591 NCBI36
  
GCCAGAGCTGCTCCTGGGAGTGCAA C → T TGAAATGCTTGGGAGAAGAGCCTCA
- 
 
n=
C/C=
C/T=
T/T=
T=
160
58
20
2
0.150
160
47
28
5
0.237
120
18
28
14
0.467
100
32
16
2
0.200
12
1
1
4
0.750
Set-II
 PDE
183681443 GRCh37
185164137 NCBI36
  
CTGGGTGGGCAAGAAGAGAAGTGAC T → C GGGTGACCCCTCCACGCTGTTCTGG
- 
 
n=
T/T=
T/C=
C/C=
C=
160
76
4
0
0.025
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 15: CodingPDE
183681341 GRCh37
185164035 NCBI36
22322067
GAGGAGCCAACCTGAGCGGTGGGCA G → A CGCCAGAGGATCAGCCTTGCCCGGG
-689
Gln = Gln
n=
G/G=
G/A=
A/A=
A=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
183677635 GRCh37
185160329 NCBI36
  
AACATGACTGGAGACTTTTTTTTTT A → T AATATTATTAGATCAATTCAAAAAA
- 
 
n=
A/A=
A/T=
T/T=
T=
160
77
3
0
0.019
160
73
7
0
0.044
120
38
18
4
0.217
100
48
2
0
0.020
12
5
1
0
0.083
Set-II
 PDEI
183677501 GRCh37
185160195 NCBI36
  
AGGAAGGTAATGGCCTTTTTTGAAA T → G TTTTAGATTTGTCATCAAAGTTTAT
- 
 
n=
T/T=
T/G=
G/G=
G=
160
73
7
0
0.044
160
67
11
2
0.094
120
46
14
0
0.117
100
47
3
0
0.030
12
5
1
0
0.083
Set-II
Exon 19: CodingPDEI
183669759 GRCh37
185152453 NCBI36
28652700
CTGTGACTCGAGGGAACGAGACCTC G → A GTGAGTGACAGCATGAAGGACAATC
-900
Ser = Ser
n=
G/G=
G/A=
A/A=
A=
160
80
0
0
0.000
160
80
0
0
0.000
120
60
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
 PDE
183669396 GRCh37
185152090 NCBI36
  
TCTCTGGACCAGTAGGAACAGAGCC G → A TCCCTGGGCCCTGACCACTCTGTGC
- 
 
n=
G/G=
G/A=
A/A=
A=
160
72
8
0
0.050
160
37
38
5
0.300
120
36
21
3
0.225
100
30
17
3
0.230
12
6
0
0
0.000
Set-II
Exon 22: CodingPDEI
183667565 GRCh37
185150259 NCBI36
33683203
GGCCTTGCCACCATCCACGCCTACA A → G TAAAGGGCAGGAGTTTCTGCACAGG
-1068
Asn → Ser
(D=46)
n=
A/A=
A/G=
G/G=
G=
160
80
0
0
0.000
160
79
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
183667526 GRCh37
185150220 NCBI36
  
TTTCTGCACAGGTTTGTCCTGATGG G → A GGCTAGAGGCCTCAAAGGGGAGTCA
- 
 
n=
G/G=
G/A=
A/A=
A=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 23: CodingPDE
183665190 GRCh37
185147884 NCBI36
35013336
TCATCAGCATCGCCCTCATCACCAC C → G ACGGGGCTGATGATCGTTCTTATGC
-1112
Thr = Thr
n=
C/C=
C/G=
G/G=
G=
160
78
2
0
0.013
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
183663620 GRCh37
185146314 NCBI36
  
ACATTAAGGTCAGACTGCTGTAGGC C → A TTTTACCGTGATCTGACTCCTCTTG
- 
 
n=
C/C=
C/A=
A/A=
A=
160
80
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
183663601 GRCh37
185146295 NCBI36
  
GTAGGCCTTTTACCGTGATCTGACT C → T CTCTTGGAGTCGGTTTACCCTTTGC
- 
 
n=
C/C=
C/T=
T/T=
T=
160
72
8
0
0.050
160
80
0
0
0.000
120
60
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
 PDE
183663588 GRCh37
185146282 NCBI36
  
CGTGATCTGACTCCTCTTGGAGTCG G → T TTTACCCTTTGCTGCCTCAGCTGGG
- 
 
n=
G/G=
G/T=
T/T=
T=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 25: CodingPDE2 pubsI
183660585 GRCh37
185143279 NCBI36
37893624
TGAGGTACCGAGAAAACCTCCCTCT C → T GTCCTAAAGAAAGTATCCTTCACGA
-1208
Leu = Leu
n=
C/C=
C/T=
T/T=
T=
160
58
20
2
0.150
160
48
28
4
0.225
120
16
30
14
0.483
100
33
15
2
0.190
12
1
1
4
0.750
Set-II
 PDE
183655609 GRCh37
185138303 NCBI36
  
TGTGGGACCACATGATGCTAGCACC G → A CCCCCTGGGACCATGAGCTCACCAT
- 
 
n=
G/G=
G/A=
A/A=
A=
160
80
0
0
0.000
160
77
3
0
0.019
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
183643255 GRCh37
185125949 NCBI36
  
ATGGACTGATTGCCATCTTTGTAGG G → A TTCTGGGCATTCAGATAAGCACTTG
- 
 
n=
G/G=
G/A=
A/A=
A=
160
69
11
0
0.069
160
80
0
0
0.000
118
59
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
Exon 30: 3UTRPDE
183639029 GRCh37
185121723 NCBI36
4538 
AGCATTGCCATTCCCTGCCTGGGGC G → A GGCCCCTCATCGCGTCCTCCTACCG
- 
 
n=
G/G=
G/A=
A/A=
A=
160
80
0
0
0.000
160
79
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 30: 3UTR
183638810 GRCh37
185121504 NCBI36
4757 
GATATAGCTACACGTATAAAGCTTC A → C TTATAGGCCTCTGATACAATTATAA
+ 
 
n=
A/A=
A/C=
C/C=
C=
134
67
0
0
0.000
136
68
0
0
0.000
130
65
0
0
0.000
134
66
1
0
0.007
n/a
0.000
PMT-272
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 30: 3UTR
183638698 GRCh37
185121392 NCBI36
4869 
CAAAAATGATAGAAAGGAATATGCA CT → - GTTATTAGCACAGTGCTTATTTTA
+ 
 
n=
CT/CT=
CT/-=
-/-=
-=
134
67
0
0
0.000
136
67
1
0
0.007
130
65
0
0
0.000
134
67
0
0
0.000
n/a
0.000
PMT-272
Exon 30: 3UTR
183638507 GRCh37
185121201 NCBI36
5060 
GTCTCCAGCCACCCCTGGAGCGGCC G → A TGGGGAGGCGGCAGAGGGGGCTGTC
+ 
 
n=
G/G=
G/A=
A/A=
A=
134
39
27
1
0.216
136
68
0
0
0.000
130
65
0
0
0.000
134
63
4
0
0.030
n/a
0.000
PMT-272
Exon 30: 3UTR
183638506 GRCh37
185121200 NCBI36
5061 
CGTCTCCAGCCACCCCTGGAGCGGC C → T GTGGGGAGGCGGCAGAGGGGGCTGT
+ 
 
n=
C/C=
C/T=
T/T=
T=
134
41
23
3
0.216
134
17
33
17
0.500
130
12
38
15
0.523
134
26
32
9
0.373
n/a
0.000
PMT-272
Exon 30: 3UTR
183638042 GRCh37
185120736 NCBI36
5525 
CAGACTTTGAGGGGAGAGAGAGAGA GAGA → - CTGTGCGACGACTGCGGTGAGA
+ 
 
n=
GAGA/GAGA=
GAGA/-=
-/-=
-=
136
59
9
0
0.066
136
66
2
0
0.015
134
45
20
2
0.179
134
63
4
0
0.030
n/a
0.000
PMT-272
Exon 30: 3UTR
183638031 GRCh37
185120725 NCBI36
5536 
GCTTAAAGTTGCAGACTTTGAGGGG A → G GAGAGAGAGAGAGACTGTGCGACGA
+ 
 
n=
A/A=
A/G=
G/G=
G=
136
68
0
0
0.000
136
67
1
0
0.007
134
67
0
0
0.000
134
67
0
0
0.000
n/a
0.000
PMT-272
Exon 30: 3UTR
183637984 GRCh37
185120678 NCBI36
5583 
AGTACAAAAACTTCTACGCCAGTGT G → C AGACACTGATTAGCAAGAGCTGCTT
+ 
 
n=
G/G=
G/C=
C/C=
C=
136
67
1
0
0.007
136
65
3
0
0.022
134
67
0
0
0.000
134
67
0
0
0.000
n/a
0.000
PMT-272
Exon 30: 3UTR3 pubsI
183637845 GRCh37
185120539 NCBI36
5722 
ACGACATGCAACGCTGACCATTCAA T → C TGATGACAGCAGTGACCACGCCCAC
+ 
 
n=
T/T=
T/C=
C/C=
C=
136
8
29
31
0.669
136
17
34
17
0.500
134
13
38
16
0.522
134
22
32
13
0.433
n/a
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.