UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:SUR1
HGNC Symbol:ABCC8
HGNC Description:ATP-binding cassette, sub-family C (CFTR/MRP), member 8
HGNC ID:59
Superfamily:ABC
Chromosome:Chr.11(-): 17414432-17498449 GRCh37
Location:11p15.1
OMIM:600509
OMIM Phenotype:Persistent Hyperinsulinemic Hypoglycemia of Infancy; Persistent Hyperinsnulinemic Hypoglycemia of Infancy due to Focal Adenomatous Hyperplasia
Accessions:NM_000352
Nucleotide RefSeq:NM_000352
Protein RefSeq:NP_000343
Entrez:6833
Ensembl:ENSG00000006071
Isoforms:2
Evidence:Substrate In Vitro Evidence: 1. Diazoxide - Ashcroft FM et al, Trends in Pharmacological Sciences, 2000: 439-445 Substrate In Vivo Evidence: 1. Gene variant associated with high insulin concentrations in non-diabetic Mexican Americans - Goksel DL et al, Human Genetics, 1998: 280-85 2. sulfonylureas - tolbutamide, glibenclamide, meglitinide (binds SUR1, but inhibits K(ATP) Channel)- Oocytes - Gribble et al, Diabetes, 1998: 1412-1418 Tissue Distribution Evidence: 1. Pancreatic b-cell - Seino S. Journal of Diabetes and Its Complications, 2003: 2-5
Tissues:pancreatic beta-cell
Type:protein-coding
Sets:V
PharmGKB ID:PA24395
HPRD ID:02741
Substrates:Diazoxide
Trivial Names:HI, SUR, HHF1, MRP8, PHHI, SUR1, ABC36, HRINS, TNDM2, SUR1delta2
Transcripts:NM_000352.3 [Chr.11(-): 17414432-17498449 GRCh37]
XM_005253088.1 [Chr.11(-): 17414432-17498386 GRCh37]
ENST00000302539 [Chr.11(-): 17414432-17498449 GRCh37]
ENST00000389817 [Chr.11(-): 17414432-17498392 GRCh37]
ENST00000524561 [Chr.11(-): 17424282-17428728 GRCh37]
ENST00000525022 [Chr.11(-): 17414588-17417462 GRCh37]
ENST00000526002 [Chr.11(-): 17452369-17464980 GRCh37]
ENST00000526037 [Chr.11(-): 17414432-17417327 GRCh37]
ENST00000526168 [Chr.11(-): 17414535-17417464 GRCh37]
ENST00000526921 [Chr.11(-): 17428224-17435099 GRCh37]
ENST00000527905 [Chr.11(-): 17418358-17498366 GRCh37]
ENST00000528202 [Chr.11(-): 17452144-17464338 GRCh37]
ENST00000528374 [Chr.11(-): 17417468-17426085 GRCh37]
ENST00000529967 [Chr.11(-): 17428430-17436117 GRCh37]
ENST00000530147 [Chr.11(-): 17431793-17435083 GRCh37]
ENST00000531137 [Chr.11(-): 17418482-17426108 GRCh37]
ENST00000531642 [Chr.11(-): 17414432-17417432 GRCh37]
ENST00000531891 [Chr.11(-): 17418480-17424225 GRCh37]
ENST00000531911 [Chr.11(-): 17432144-17449640 GRCh37]
ENST00000532220 [Chr.11(-): 17417460-17419055 GRCh37]
ENST00000532728 [Chr.11(-): 17452111-17498354 GRCh37]

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for ABCC8.

Variant Data

View all PMT variants for ABCC8 on UCSC Genome Browser
Showing SNP features for transcript:   
ABCC8 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:ABCC8 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
17498761 GRCh37
17455337 NCBI36
-312-438
AGGCCTGGAGTGGGCGGGTTCAGGG T → A CCCGAGTGTGAGTTCACCTGGGCGT
+ 
 
n=
T/T=
T/A=
A/A=
A=
130
60
5
0
0.038
126
55
8
0
0.063
130
54
11
0
0.085
122
60
1
0
0.008
PMT-272
Exon 1: 5UTR
Promoter
PDE
17498411 GRCh37
17454987 NCBI36
39-88
CGCCTCTGTCCCTTGCAGCTCCGCC G → T CCCGGCCCGGCCGTCAGGCCCCCGC
+ 
 
n=
G/G=
G/T=
T/T=
T=
132
65
1
0
0.008
128
64
0
0
0.000
130
65
0
0
0.000
124
62
0
0
0.000
PMT-272
Exon 1: 5UTRPDE
17498395 GRCh37
17454971 NCBI36
55-72
CTCCGCGCGCCTGCCGCGCCTCTGT C → T CCTTGCAGCTCCGCCGCCCGGCCCG
+ 
 
n=
C/C=
C/T=
T/T=
T=
132
66
0
0
0.000
132
66
0
0
0.000
132
66
0
0
0.000
124
60
2
0
0.016
PMT-272
Exon 1: 5UTRPDE
17498381 GRCh37
17454957 NCBI36
69-58
GCTGGCTCCGCTGGCTCCGCGCGCC T → A GCCGCGCCTCTGTCCCTTGCAGCTC
+ 
 
n=
T/T=
T/A=
A/A=
A=
132
66
0
0
0.000
132
66
0
0
0.000
132
66
0
0
0.000
122
60
1
0
0.008
PMT-272
Exon 1: 5UTRPDE
17498375 GRCh37
17454951 NCBI36
75-52
GGCTCAGCTGGCTCCGCTGGCTCCG C → CTGGCTCCGC GCGCCTGCCGCGCCTCTGTCCCTTG
+ 
 
n=
C/C=
C/CTGGCTCCGC=
CTGGCTCCGC/CTGGCTCCGC=
CTGGCTCCGC=
132
65
1
0
0.008
132
66
0
0
0.000
132
66
0
0
0.000
122
61
0
0
0.000
PMT-272
Exon 1: 5UTRPDE1 pub
17498372 GRCh37
17454948 NCBI36
78-49
TCGGGCTCAGCTGGCTCCGCTGGCT C → G CGCGCGCCTGCCGCGCCTCTGTCCC
+ 
 
n=
C/C=
C/G=
G/G=
G=
132
58
8
0
0.061
132
66
0
0
0.000
132
66
0
0
0.000
122
60
1
0
0.008
PMT-272
Exon 1: 5UTRPDE
17498331 GRCh37
17454907 NCBI36
119-8
GCAGAAGGCCAGGGGCATGGCGGCG C → A GGGCGCGGGCTGGGCTCGGGCTCAG
+ 
 
n=
C/C=
C/A=
A/A=
A=
130
65
0
0
0.000
126
62
1
0
0.008
130
65
0
0
0.000
122
61
0
0
0.000
PMT-272
 PDE
17414779 GRCh37
17371355 NCBI36
  
CTGCGGCTTGGAGGAGGAGGATGAG G → - CATGTGGCCAGAATGTCCTGTCACT
+ 
 
n=
G/G=
G/-=
-/-=
-=
136
57
9
2
0.096
134
25
34
8
0.373
136
15
25
28
0.596
136
46
20
2
0.176
PMT-272
 PDE
17414757 GRCh37
17371333 NCBI36
  
GCCACAGCTGAGGGTGGCCCTCCTG C → T GGCTTGGAGGAGGAGGATGAGGCAT
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
65
3
0
0.022
134
26
33
8
0.366
136
64
4
0
0.029
136
51
17
0
0.125
PMT-272
 PDE
17414731 GRCh37
17371307 NCBI36
  
TGGTGGGAATACCACCCGCGGTGGG G → A GCCACAGCTGAGGGTGGCCCTCCTG
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
67
1
0
0.007
134
67
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
 PDEI
17414715 GRCh37
17371291 NCBI36
  
AGGGGGCGGGTCAGGATGGTGGGAA T → C ACCACCCGCGGTGGGGGCCACAGCT
+ 
 
n=
T/T=
T/C=
C/C=
C=
136
26
30
12
0.397
134
29
33
5
0.321
136
59
8
1
0.074
136
20
31
17
0.478
PMT-272
Exon 39: CodingPDE1 pubI
17414570 GRCh37
17371146 NCBI36
48404714
TCTGCACGGACGAAGGAGGCGAAGA C → T GCTGTCCTTCCGGCTGAGCAGCTTC
+1572
Val → Ile
(D=29)
n=
C/C=
C/T=
T/T=
T=
136
64
4
0
0.029
134
61
6
0
0.045
136
68
0
0
0.000
136
61
7
0
0.051
PMT-272
Exon 39: CodingPDE
17414556 GRCh37
17371132 NCBI36
48544728
TGGCAGGTCACTTGTCTGCACGGAC G → A AAGGAGGCGAAGACGCTGTCCTTCC
+1576
Phe = Phe
n=
G/G=
G/A=
A/A=
A=
136
64
4
0
0.029
134
67
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
 PDE
17414420 GRCh37
17370996 NCBI36
  
ACCGCCAGCCCCTGCCCACCAGACT T → C AGGGCCTCTAGTAGGAAATAATCAA
+ 
 
n=
T/T=
T/C=
C/C=
C=
136
68
0
0
0.000
134
66
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
 PDE
17414409 GRCh37
17370985 NCBI36
  
ACCCACCATCCACCGCCAGCCCCTG C → T CCACCAGACTTAGGGCCTCTAGTAG
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
67
1
0
0.007
134
66
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.