UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:SUR2
HGNC Symbol:ABCC9
HGNC Description:ATP-binding cassette, sub-family C (CFTR/MRP), member 9
HGNC ID:60
Superfamily:ABC
Chromosome:Chr.12(-): 21950323-22094797 GRCh37
Location:12p12.1
OMIM:601439
OMIM Phenotype:cardiomyopathy, dilated with ventricular tachycardia
Accessions:NM_005691
Nucleotide RefSeq:NM_005691
Protein RefSeq:NP_005682
Entrez:10060
Ensembl:ENSG00000069431
Isoforms:10
Evidence:Substrate In Vitro Evidence: 1 Pinacidil, nicorandil, cromakalim, Ashcroft FM et al, Trends in Pharmacological Sciences, 2000: 439-445 Substrate In Vivo Evidence: 1. Sulfonylureas - glibenclamide, miglitinide - Oocytes - Gribble et al, Diabetes, 1998: 1412-1418 Tissue Distribution Evidence: 1. Heart, skeletal muscle, ovary - Northern Blot, Inagaki N et al, Neuron, 1996: 1011-17
Tissues:heart, skeletal muscle, ovary
Type:protein-coding
Sets:V
PharmGKB ID:PA396
HPRD ID:03258
Substrates:pinacidil, nicorandil, cromakalim
Trivial Names:SUR2, ABC37, CANTU, CMD1O, ATFB12
Transcripts:NM_005691.2 [Chr.12(-): 21958108-22089628 GRCh37]
NM_020297.2 [Chr.12(-): 21950323-22089628 GRCh37]
XM_005253288.1 [Chr.12(-): 21950323-22094797 GRCh37]
XM_005253290.1 [Chr.12(-): 21950323-22094797 GRCh37]
XM_005253289.1 [Chr.12(-): 21950323-22094797 GRCh37]
XM_005253284.1 [Chr.12(-): 21950323-22094797 GRCh37]
XM_005253286.1 [Chr.12(-): 21950323-22094797 GRCh37]
XM_005253285.1 [Chr.12(-): 21950323-22094133 GRCh37]
XM_005253287.1 [Chr.12(-): 21954030-22094797 GRCh37]
XM_005253291.1 [Chr.12(-): 21980073-22094797 GRCh37]
ENST00000261200 [Chr.12(-): 21950335-22089608 GRCh37]
ENST00000261201 [Chr.12(-): 21958108-22089608 GRCh37]
ENST00000326684 [Chr.12(-): 22075903-22094336 GRCh37]
ENST00000345162 [Chr.12(-): 21958108-22089628 GRCh37]
ENST00000538350 [Chr.12(-): 22076398-22094167 GRCh37]
ENST00000544039 [Chr.12(-): 21958108-22063912 GRCh37]
Annotation History:View Events (76)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for ABCC9.

Variant Data

View all PMT variants for ABCC9 on UCSC Genome Browser
Showing SNP features for transcript:   
ABCC9 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:ABCC9 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
22089942 GRCh37
21981209 NCBI36
-314-334
AAAATGCTTTCAAAGAACAAAAATG G → A TCATATATTAAGAAAAAGGAGAAAA
+ 
 
n=
G/G=
G/A=
A/A=
A=
126
63
0
0
0.000
136
67
1
0
0.007
120
60
0
0
0.000
122
61
0
0
0.000
PMT-272
 PDE
22089933 GRCh37
21981200 NCBI36
-305-325
TGTCTGACTAAAATGCTTTCAAAGA A → G CAAAAATGGTCATATATTAAGAAAA
+ 
 
n=
A/A=
A/G=
G/G=
G=
126
61
2
0
0.016
136
68
0
0
0.000
120
60
0
0
0.000
122
61
0
0
0.000
PMT-272
PromoterPDE
22089744 GRCh37
21981011 NCBI36
-116-136
ATAAAATTAATCCCTTTTACTTTGA T → C AGCTGAGGAAATAAGAAACTCTGTG
+ 
 
n=
T/T=
T/C=
C/C=
C=
126
59
4
0
0.032
136
68
0
0
0.000
120
60
0
0
0.000
122
60
1
0
0.008
PMT-272
Exon 1: 5UTR
Promoter
PDE
22089619 GRCh37
21980886 NCBI36
10-11
AAATGAAAGGCTCATTTCTTCTTAT A → G TGGTTTACTCTAAAAGGGAGAGAAA
+ 
 
n=
A/A=
A/G=
G/G=
G=
126
63
0
0
0.000
136
67
1
0
0.007
120
60
0
0
0.000
122
61
0
0
0.000
PMT-272
 PDE
21959053 GRCh37
21850320 NCBI36
  
ATTACTTTGTCATCATAATATTTTG C → T CCCAAGAACAATCAATATTCCACTG
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
 PDE
21959039 GRCh37
21850306 NCBI36
  
TAAATTTTCTCGGGATTACTTTGTC A → G TCATAATATTTTGCCCCAAGAACAA
+ 
 
n=
A/A=
A/G=
G/G=
G=
136
66
2
0
0.015
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
 PDE
21958876 GRCh37
21850143 NCBI36
  
ATATTTTGCTAAAACCTAAAGATGA T → A AACATGTTAGAACAAAAACCAAAGA
+ 
 
n=
T/T=
T/A=
A/A=
A=
136
68
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
PMT-272
 PDE
21958820 GRCh37
21850087 NCBI36
  
TCTTTTTTGCACAGATACAGAAACA T → TA TAGCAGAGAAATACATAATTCAACA
+ 
 
n=
T/T=
T/TA=
TA/TA=
TA=
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.