UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:ALD
HGNC Symbol:ABCD1
HGNC Description:ATP-binding cassette, sub-family D (ALD), member 1
HGNC ID:61
Superfamily:ABC
Chromosome:Chr.X(+): 152990323-153010216 GRCh37
Location:Xq28
OMIM:300371
OMIM Phenotype:Adrenoleukodystrophy; Addison disease; Adrenomyeloneuropathy
Accessions:NM_000033
Nucleotide RefSeq:NM_000033
Protein RefSeq:NP_000024
Entrez:215
Ensembl:ENSG00000101986
Isoforms:1
Evidence:Substrate In Vitro Evidence: Very long chain fatty acids (VLCFA) - Inferred substrate 1. Yeast homolog. Hettema EH and Tabak HF. Biochim Biophys Acta. 2000 Jun 26;1486(1):18-27. 2. SV40T transformation of human skin fibroblasts. Braiterman LT, et al. Mol Genet Metab. 1999 Feb;66(2):91-9. Tissue Distribution Evidence: Lung > Uterus, Testis, Placenta > Adrenal gland, Prostate, Spleen, Heart - TaqMan RT-PCR. Langmann T, et al. Clinical Chemistry. 2003; 49: 230-8.
Tissues:Lung > Uterus, Testis, Placenta > Adrenal gland, Prostate, Spleen, Heart
Type:protein-coding
Sets:V
PharmGKB ID:PA24396
HPRD ID:02300
Substrates:Very long chain fatty acids (VLCFA)
Trivial Names:ALD, AMN, ALDP, ABC42
Transcripts:NM_000033.3 [Chr.X(+): 152990323-153010216 GRCh37]
ENST00000218104 [Chr.X(+): 152990323-153010216 GRCh37]
ENST00000370129 [Chr.X(+): 152991272-152995352 GRCh37]
ENST00000443684 [Chr.X(+): 153000798-153006058 GRCh37]

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for ABCD1.

Variant Data

View all PMT variants for ABCD1 on UCSC Genome Browser
Showing SNP features for transcript: NM_000033  
ABCD1 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:ABCD1 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 
152989888 GRCh37
152643082 NCBI36
-435-834
TCATACCGCGGCCGGAAACCGGAAG C → T GCCCGCCGGGCACCGCCCACCAGCC
+ 
 
n=
C/C=
C/T=
T/T=
T=
128
58
6
0
0.047
132
66
0
0
0.000
126
63
0
0
0.000
132
66
0
0
0.000
PMT-272
 
152989989 GRCh37
152643183 NCBI36
-334-733
GAGCGGAGGGCCGGCGCTCCGAGCG G → C GAGAGGAAGAGGCGCCTCGGGCTCC
+ 
 
n=
G/G=
G/C=
C/C=
C=
128
20
18
26
0.547
132
59
3
4
0.083
128
52
10
2
0.109
132
55
6
5
0.121
PMT-272
Promoter
152990161 GRCh37
152643355 NCBI36
-162-561
CCCGCCGAGGGGCGAGAACGGGAGG T → G GGGGGTGTGGGCGGGCCCCGCCGAG
+ 
 
n=
T/T=
T/G=
G/G=
G=
128
63
1
0
0.008
132
66
0
0
0.000
128
60
3
1
0.039
132
66
0
0
0.000
PMT-272
Promoter
152990197 GRCh37
152643391 NCBI36
-126-525
GCGGGCCCCGCCGAGGGGCGAGAAC A → G GGGTGGGGCTCCCGCGCCCGGACTC
+ 
 
n=
A/A=
A/G=
G/G=
G=
128
63
0
1
0.016
132
66
0
0
0.000
128
64
0
0
0.000
132
66
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.