UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:ABC39
HGNC Symbol:ABCD2
HGNC Description:ATP-binding cassette, sub-family D (ALD), member 2
HGNC ID:66
Superfamily:ABC
Chromosome:Chr.12(-): 39945022-40013843 GRCh37
Location:12q12
OMIM:601081
OMIM Phenotype:None
Accessions:AH007710
Nucleotide RefSeq:NM_005164
Protein RefSeq:NP_005155
Entrez:225
Ensembl:ENSG00000173208
Isoforms:1
Evidence:Tissue Distribution Evidence: Brain, Heart, Lung, Colon, Thymus, Uterus, Leukocytes, Liver - Northern blot and RT-PCR. Holzinger A, Biochem Biophys Res Commun. 1997 Oct 9;239(1):261-4. - Generally located in peroxisomal membranes
Tissues:Brain, Heart, Lung, Colon, Thymus, Uterus, Leukocytes, Liver
Type:protein-coding
Sets:0
PharmGKB ID:PA24401
HPRD ID:03051
Substrates:No data
Trivial Names:ALDR, ABC39, ALDL1, ALDRP, hALDR
Transcripts:NM_005164.3 [Chr.12(-): 39945022-40013843 GRCh37]
ENST00000308666 [Chr.12(-): 39943835-40013553 GRCh37]
Annotation History:View Events (1)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for ABCD2.

Variant Data

View all PMT variants for ABCD2 on UCSC Genome Browser
Showing SNP features for transcript: NM_005164  
ABCD2 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:ABCD2 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDEI
40014427 GRCh37
38300694 NCBI36
-584-1010
AAATAATTATTTGCTATGCCTCTAG C → T CATTCTCCCTTTTTCCTCTGCATCC
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
50
15
0
0.115
132
50
16
0
0.121
136
48
18
2
0.162
134
53
14
0
0.104
PMT-272
 PDE
40014292 GRCh37
38300559 NCBI36
-449-875
TGGATCTGTTTTTCACAGATCCCCC C → T GGCTTTTTTGGGGGTCTGATTTCAC
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
60
5
0
0.038
132
66
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
 PDE
40014264 GRCh37
38300531 NCBI36
-421-847
CCGGAGAATGCCAAATATCAAATAC A → G CTTGGATCTGTTTTTCACAGATCCC
+ 
 
n=
A/A=
A/G=
G/G=
G=
130
64
1
0
0.008
132
66
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
PromoterPDE
40013901 GRCh37
38300168 NCBI36
-58-484
CAGAAGTTTCAGAATATACATCACT T → C CGGTAAGATTTCAGTAGATACCGCA
+ 
 
n=
T/T=
T/C=
C/C=
C=
130
64
1
0
0.008
132
62
4
0
0.030
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
Exon 1: 5UTR
Promoter
PDE
40013801 GRCh37
38300068 NCBI36
43-384
AGTTAAAATGTCTATTTTTGGAGAG G → A TCGAATCAGGCCATCTGCTGGCGAA
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
65
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
Exon 1: 5UTRPDE
40013638 GRCh37
38299905 NCBI36
206-221
ATGATTCTCTCAGAAGCTCAAGCTG C → A ACCAAGCTCCTCCCTCCCAGGCCCC
+ 
 
n=
C/C=
C/A=
A/A=
A=
130
65
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
Exon 1: 5UTRPDE
40013609 GRCh37
38299876 NCBI36
235-192
GAGCTCAGACTCCGCTGCATCTACC G → A GGAATGATTCTCTCAGAAGCTCAAG
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
65
0
0
0.000
136
65
3
0
0.022
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
Exon 1: CodingPDE
40013392 GRCh37
38299659 NCBI36
45226
CGATCTGGTCCATTTCACTCGATCA G → C CTGCTGCATTTAGCATATGTGTCAT
+9
Ala → Gly
(D=60)
n=
G/G=
G/C=
C/C=
C=
130
65
0
0
0.000
136
68
0
0
0.000
136
65
3
0
0.022
134
64
3
0
0.022
PMT-272
Exon 1: CodingPDE
40013230 GRCh37
38299497 NCBI36
614188
GGTCTCGGTGCAATGCAGTATTTCT G → C TGTTCTCTGCAGCAGGGTAAGCTGC
+63
Thr → Arg
(D=71)
n=
G/G=
G/C=
C/C=
C=
130
61
4
0
0.031
136
68
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
Exon 1: CodingPDE
40013153 GRCh37
38299420 NCBI36
691265
GGAAACAAAATTTTCCGAAGTTCTA G → A TAGCTGTTTGAAGAAATCTGCATTC
+89
Leu = Leu
n=
G/G=
G/A=
A/A=
A=
130
62
3
0
0.023
136
68
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
 PDE
39948077 GRCh37
38234344 NCBI36
  
TTGAGTTTTAAGGACATATCAAAAA G → C TTAAATACTGTGATTTTTTTAAAAC
+ 
 
n=
G/G=
G/C=
C/C=
C=
134
62
5
0
0.037
136
68
0
0
0.000
134
67
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 10: CodingPDE
39947885 GRCh37
38234152 NCBI36
24782052
GGATAGCAGTATCCAATTGTTCAAA G → A CGCCAACCTCCTTCACCATCAAACT
+684
Arg = Arg
n=
G/G=
G/A=
A/A=
A=
134
63
4
0
0.030
136
68
0
0
0.000
134
67
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 10: 3UTRPDE
39947694 GRCh37
38233961 NCBI36
2669 
TGAGCCTTTATCTAATAATTAACTT T → G TAAAATATGTCAAAACAAATTAAGA
+ 
 
n=
T/T=
T/G=
G/G=
G=
134
63
4
0
0.030
136
68
0
0
0.000
134
67
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 10: 3UTRPDE
39947679 GRCh37
38233946 NCBI36
2684 
ATAACAGAATGTCTTTGAGCCTTTA T → A CTAATAATTAACTTTTAAAATATGT
+ 
 
n=
T/T=
T/A=
A/A=
A=
134
66
1
0
0.007
136
68
0
0
0.000
134
67
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 10: 3UTRPDE
39947588 GRCh37
38233855 NCBI36
2775 
CAGATCATATACTTCCTTAATGCTA A → G AATCTTATAAAACATGTCTTGCTGC
+ 
 
n=
A/A=
A/G=
G/G=
G=
134
67
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
136
67
1
0
0.007
PMT-272
Exon 10: 3UTRPDE
39947405 GRCh37
38233672 NCBI36
2958 
AGAATATTGCCCATGTTTGTTAAGA A → G CTTCAGACACACCACATATACATAG
+ 
 
n=
A/A=
A/G=
G/G=
G=
132
59
6
1
0.061
136
68
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
Exon 10: 3UTRPDE
39947359 GRCh37
38233626 NCBI36
3004 
CTTGGTATCAACCCAAATGCTGCTC A → C GTTTAACTTGTTTCATTTCCAGAAT
+ 
 
n=
A/A=
A/C=
C/C=
C=
132
66
0
0
0.000
136
65
3
0
0.022
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
Exon 10: 3UTRPDEI
39947325 GRCh37
38233592 NCBI36
3038 
GACTAAATGTCACTCAAAGTTTGAA T → C CTTATGCACTTGGTATCAACCCAAA
+ 
 
n=
T/T=
T/C=
C/C=
C=
132
63
3
0
0.023
136
63
5
0
0.037
136
45
18
5
0.206
134
55
12
0
0.090
PMT-272
Exon 10: 3UTRPDEI
39947308 GRCh37
38233575 NCBI36
3055 
AATATCAACCATAAATGGACTAAAT G → A TCACTCAAAGTTTGAATCTTATGCA
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
51
15
0
0.114
136
53
15
0
0.110
136
49
17
2
0.154
134
56
11
0
0.082
PMT-272
Exon 10: 3UTRPDE
39947255 GRCh37
38233522 NCBI36
3108 
CAGGTTTAGTTGGCCACTAGCAATA A → C TCAATTTGAATTCTAGCTATTAAAC
+ 
 
n=
A/A=
A/C=
C/C=
C=
132
66
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
134
67
0
0
0.000
PMT-272
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
Exon 10: 3UTRPDE
39947140 GRCh37
38233407 NCBI36
3223 
CAAAATTTAAAAATATGGCATTTTA T → C ACATTTTAGCCATGCTTTTTTCTTT
+ 
 
n=
T/T=
T/C=
C/C=
C=
132
65
1
0
0.008
136
68
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
Exon 10: 3UTRPDE
39946776 GRCh37
38233043 NCBI36
3587 
ATAGTATTTGTTTCAAAACATTGTC A → G TCAACATTAAGGTGAAATGATGTAA
+ 
 
n=
A/A=
A/G=
G/G=
G=
134
67
0
0
0.000
134
67
0
0
0.000
136
68
0
0
0.000
132
65
1
0
0.008
PMT-272
Exon 10: 3UTRPDEI
39946653 GRCh37
38232920 NCBI36
3710 
AACAAAAGAGCACTAAACCAGAGAG T → G CAGGAGAACTTCATTTGATTTCTCG
+ 
 
n=
T/T=
T/G=
G/G=
G=
134
62
5
0
0.037
134
59
8
0
0.060
136
51
15
2
0.140
132
64
2
0
0.015
PMT-272
Exon 10: 3UTRPDE
39946581 GRCh37
38232848 NCBI36
3782 
AAATTTATTTTATTTTCTACACTTC G → A TCTAACTTTTATTGCTATTATAGCC
+ 
 
n=
G/G=
G/A=
A/A=
A=
134
66
1
0
0.007
134
67
0
0
0.000
136
68
0
0
0.000
132
46
17
3
0.174
PMT-272
Exon 10: 3UTRPDE
39946474 GRCh37
38232741 NCBI36
3889 
TAACTTTCTCATTTCATTTTAAGCC G → A CAGAACAATGATCTTTGCACTTTGT
+ 
 
n=
G/G=
G/A=
A/A=
A=
134
67
0
0
0.000
134
65
2
0
0.015
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 10: 3UTRPDE
39946473 GRCh37
38232740 NCBI36
3890 
CTAACTTTCTCATTTCATTTTAAGC C → T GCAGAACAATGATCTTTGCACTTTG
+ 
 
n=
C/C=
C/T=
T/T=
T=
134
55
12
0
0.090
134
67
0
0
0.000
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 10: 3UTRPDEI
39946354 GRCh37
38232621 NCBI36
4009 
TCTCATTATGTTCAATAAATATTAA C → A TTTACCAAAACCATAATTATTTGCC
+ 
 
n=
C/C=
C/A=
A/A=
A=
134
12
32
23
0.582
134
44
22
1
0.179
136
28
27
13
0.390
132
39
26
1
0.212
PMT-272
Exon 10: 3UTRPDE
39945941 GRCh37
38232208 NCBI36
4422 
AGTAGGTGATAATACTAATGAAAAC G → T TTGGACAAATGTACTGATTATAATT
+ 
 
n=
G/G=
G/T=
T/T=
T=
136
68
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
Exon 10: 3UTRPDE
39945253 GRCh37
38231520 NCBI36
5110 
TTTCTCAGTCTTTTTCATGTTTTCC G → A TAAAATATAAGAGTAGTAAAATATG
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
45
19
1
0.162
130
63
2
0
0.015
132
62
4
0
0.030
134
62
5
0
0.037
PMT-272
Exon 10: 3UTRPDE
39945161 GRCh37
38231428 NCBI36
5202 
AGATATAACATGGTAAAAGTAGTTT G → A AAACTTGAAATATTCTTTCTTTTTT
+ 
 
n=
G/G=
G/A=
A/A=
A=
122
61
0
0
0.000
130
64
1
0
0.008
126
63
0
0
0.000
130
65
0
0
0.000
PMT-272
Exon 10: 3UTRPDE
39945053 GRCh37
38231320 NCBI36
5310 
TATTTTTCAAGTTTAAGAGTTAACC T → G AAAGAATGCACATTTTAAACTCAAG
+ 
 
n=
T/T=
T/G=
G/G=
G=
122
57
4
0
0.033
130
65
0
0
0.000
126
63
0
0
0.000
130
65
0
0
0.000
PMT-272
 PDE
39945002 GRCh37
38231269 NCBI36
  
TAACATTACATGCTGTAGAAATATA A → G TGCAACGTTTTCATAGAATCCAACT
+ 
 
n=
A/A=
A/G=
G/G=
G=
122
59
2
0
0.016
130
65
0
0
0.000
126
63
0
0
0.000
130
65
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.