UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:ABC43
HGNC Symbol:ABCD3
HGNC Description:ATP-binding cassette, sub-family D (ALD), member 3
HGNC ID:67
Superfamily:ABC
Chromosome:Chr.1(+): 94883933-94984219 GRCh37
Location:1p21.3
OMIM:170995
OMIM Phenotype:Zellweger syndrome 2
Accessions:M81182,X58528,X83467
Nucleotide RefSeq:NM_002858
Protein RefSeq:NP_002849
Entrez:5825
Ensembl:ENSG00000117528
Isoforms:6
Evidence:Substrate In Vitro Evidence: 1. The interaction between peroxisomal ABC transporters with ATP was examined using rat liver peroxisomes. Findings suggested that ATP binds to PMP70 tightly in the absence of Mg2+. In the presence of Mg2+, the bound ATP is hydrolyzed to ADP, which is then dissociated from PMP70. ATP binding/hydrolysis by and the phosphorylation of PMP70 and ALDP are involved in the regulation of fatty acid transport into peroxisomes. Tanaka, AR et al. JBC 2002 Oct 18, 277(42):40142-7 PMID 12176987. 2. Co-IP demonstrated the heterodimerization of PMP70 with ALDRP (adrenoleukodystrophy related protein) or ALDP (adrenoleukodystrophy protein). Loss of ALDP dimerization may play a role in X-linked adrenoleukodystrophy pathogenesis (VLCFAs accumulate because of their impaired peroxisomal beta-oxidation). Liu, LX et al. JBC 1999 Nov 12, 274(46):32738-43 PMID 10551832. 3. Nucleotide-induced conformational changes of PMP70 were investigated by limited-trypsin digestion in rat liver peroxisomes. The results suggested that PMP70 exists as a dimer on the peroxisomal membranes and the binding and hydrolysis of ATP induce conformational changes in PMP70. Kashiwayama, Y et al. Biochem Biophys Res Comm 2002 Mar 15, 291(5):1245-51 PMID 11883951. Substrate In Vivo Evidence: 1. Zellweger syndrome (ZS) is an inborn error of peroxisome assembly. Two mutant PMP70 alleles in ZS probands suggest that PMP70 plays an important role in peroxisome biogenesis and that mutations in PMP70 may be responsible for a subset of ZS patients. Gartner, J; Moser, H; Valle, D. Nat Genet 1992 Apr, 1(1):16-23 PMID 1301993. Tissue Distribution Evidence: 1. Electron microscopy, immunocytochemistry, and 3D image reconstruction of peroxisomes and associated compartments in mouse dendritic cells demonstrated the presence of PMP70 in specialized subdomains of the ER that were continuous with a peroxisomal reticulum from which mature peroxisomes arose. Geuze, HJ et al. Mol Biol Cell 2003 Jul, 14(7):2900-7 PMID 12857873.
Tissues:endoplasmic reticulum
Type:protein-coding
Sets:0
PharmGKB ID:PA24402
HPRD ID:01368
Substrates:binds ATP and is phosphorylated
Trivial Names:ZWS2, ABC43, PMP70, PXMP1
Transcripts:NM_002858.3 [Chr.1(+): 94883933-94984219 GRCh37]
NM_001122674.1 [Chr.1(+): 94883933-94944260 GRCh37]
XM_005271088.1 [Chr.1(+): 94883948-94984219 GRCh37]
XM_005271090.1 [Chr.1(+): 94883948-94984219 GRCh37]
XM_005271087.1 [Chr.1(+): 94883972-94984219 GRCh37]
XM_005271089.1 [Chr.1(+): 94884863-94984219 GRCh37]
ENST00000315713 [Chr.1(+): 94884035-94944279 GRCh37]
ENST00000370214 [Chr.1(+): 94884011-94984219 GRCh37]
ENST00000394233 [Chr.1(+): 94883933-94984219 GRCh37]
ENST00000454898 [Chr.1(+): 94883969-94982836 GRCh37]
ENST00000464165 [Chr.1(+): 94979030-94984052 GRCh37]
ENST00000468860 [Chr.1(+): 94884387-94941250 GRCh37]
ENST00000484213 [Chr.1(+): 94947049-94984222 GRCh37]
ENST00000493416 [Chr.1(+): 94945778-94953347 GRCh37]
ENST00000536817 [Chr.1(+): 94883971-94983158 GRCh37]

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for ABCD3.

Variant Data

View all PMT variants for ABCD3 on UCSC Genome Browser
Showing SNP features for transcript:   
ABCD3 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:ABCD3 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
PromoterPDE
94883882 GRCh37
94656470 NCBI36
-51-153
AGTACAAAGTGGGCTCCAGAGCGCG G → A GCGGCGCGGCGGCGCGAGCCAGGGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
66
0
0
0.000
128
64
0
0
0.000
136
67
1
0
0.007
130
65
0
0
0.000
PMT-272
PromoterPDE
94883914 GRCh37
94656502 NCBI36
-19-121
CGGCGGCGCGAGCCAGGGGGCGGTC C → T TGCGCGGCCGGCCCCGCCCTCTGCT
+ 
 
n=
C/C=
C/T=
T/T=
T=
132
65
1
0
0.008
128
64
0
0
0.000
136
68
0
0
0.000
130
65
0
0
0.000
PMT-272
Exon 1: 5UTRPDE
94883995 GRCh37
94656583 NCBI36
63-40

C → CGCCGC, T
GTAAGGTAGCCGCCGCCGCCGCCGC C → CGCCGC GCCGCGTCCCCTCGCCGGCTCGCTG
GTAAGGTAGCCGCCGCCGCCGCCGC C → T GCCGCGTCCCCTCGCCGGCTCGCTG
+ 

 
 
 
n=
C/C=
C/CGCCGC=
CGCCGC/CGCCGC=
C/T=
T/T=
CGCCGC/T=
CGCCGC=
T=
132
61
5
0
0
0
0
0.038
0.000
128
55
2
0
7
0
0
0.016
0.055
136
45
2
0
16
5
0
0.015
0.191
130
57
2
0
5
1
0
0.015
0.054
PMT-272
Exon 1: 5UTRPDE
94883999 GRCh37
94656587 NCBI36
67-36
GGTAGCCGCCGCCGCCGCCGCCGCC G → T CGTCCCCTCGCCGGCTCGCTGGTAC
+ 
 
n=
G/G=
G/T=
T/T=
T=
132
60
5
1
0.053
128
64
0
0
0.000
136
68
0
0
0.000
130
65
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.