UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:ABC41
HGNC Symbol:ABCD4
HGNC Description:ATP-binding cassette, sub-family D (ALD), member 4
HGNC ID:68
Superfamily:ABC
Chromosome:Chr.14(-): 74751980-74769767 GRCh37
Location:14q24.3
OMIM:603214
OMIM Phenotype:None
Accessions:AF009746
Nucleotide RefSeq:NM_005050
Protein RefSeq:NP_005041
Entrez:5826
Ensembl:ENSG00000119688
Isoforms:21
Evidence:Tissue Distribution Evidence: Ubiquitous - Northern blot and RT-PCR. Holzinger A, et al. Biochem Biophys Res Commun. 1997 Aug 8;237(1):152-7.
Tissues:Ubiquitous
Type:protein-coding
Sets:0
PharmGKB ID:PA24403
HPRD ID:04446
Substrates:No data
Trivial Names:P70R, P79R, ABC41, MAHCJ, PMP69, PXMP1L, EST352188
Transcripts:NM_005050.3 [Chr.14(-): 74751980-74769767 GRCh37]
XM_005267937.1 [Chr.14(-): 74752130-74769706 GRCh37]
XM_005267935.1 [Chr.14(-): 74752130-74769669 GRCh37]
XM_005267949.1 [Chr.14(-): 74752671-74769765 GRCh37]
XM_005267954.1 [Chr.14(-): 74752671-74769703 GRCh37]
XM_005267939.1 [Chr.14(-): 74752671-74769700 GRCh37]
XM_005267950.1 [Chr.14(-): 74752671-74769698 GRCh37]
XM_005267945.1 [Chr.14(-): 74752671-74769698 GRCh37]
XM_005267948.1 [Chr.14(-): 74752671-74769698 GRCh37]
XM_005267944.1 [Chr.14(-): 74752671-74769690 GRCh37]
XM_005267951.1 [Chr.14(-): 74752671-74769662 GRCh37]
XM_005267947.1 [Chr.14(-): 74752671-74769662 GRCh37]
XM_005267946.1 [Chr.14(-): 74752671-74769658 GRCh37]
XM_005267940.1 [Chr.14(-): 74752671-74769637 GRCh37]
XM_005267941.1 [Chr.14(-): 74752671-74769637 GRCh37]
XM_005267952.1 [Chr.14(-): 74752671-74769627 GRCh37]
XM_005267942.1 [Chr.14(-): 74752671-74769622 GRCh37]
XM_005267953.1 [Chr.14(-): 74752671-74766375 GRCh37]
XM_005267936.1 [Chr.14(-): 74755825-74769669 GRCh37]
XM_005267938.1 [Chr.14(-): 74755855-74769669 GRCh37]
XM_005267943.1 [Chr.14(-): 74756230-74769669 GRCh37]
ENST00000298816 [Chr.14(-): 74753273-74769672 GRCh37]
ENST00000356924 [Chr.14(-): 74752126-74769759 GRCh37]
ENST00000460308 [Chr.14(-): 74759025-74769758 GRCh37]
ENST00000465085 [Chr.14(-): 74753229-74755344 GRCh37]
ENST00000466822 [Chr.14(-): 74756004-74757202 GRCh37]
ENST00000469672 [Chr.14(-): 74757081-74769695 GRCh37]
ENST00000470637 [Chr.14(-): 74762582-74769662 GRCh37]
ENST00000474270 [Chr.14(-): 74753413-74759529 GRCh37]
ENST00000475240 [Chr.14(-): 74762433-74769637 GRCh37]
ENST00000477803 [Chr.14(-): 74764539-74769690 GRCh37]
ENST00000481348 [Chr.14(-): 74752699-74757155 GRCh37]
ENST00000481935 [Chr.14(-): 74752717-74769640 GRCh37]
ENST00000484380 [Chr.14(-): 74754514-74756656 GRCh37]
ENST00000489207 [Chr.14(-): 74766602-74769700 GRCh37]
ENST00000489678 [Chr.14(-): 74760757-74764772 GRCh37]
ENST00000493427 [Chr.14(-): 74765764-74769698 GRCh37]
ENST00000493752 [Chr.14(-): 74765881-74769679 GRCh37]
ENST00000496015 [Chr.14(-): 74755782-74762617 GRCh37]
ENST00000553486 [Chr.14(-): 74753048-74769648 GRCh37]
ENST00000553745 [Chr.14(-): 74753273-74769672 GRCh37]
ENST00000553998 [Chr.14(-): 74759254-74762643 GRCh37]
ENST00000554453 [Chr.14(-): 74759451-74769621 GRCh37]
ENST00000555617 [Chr.14(-): 74759307-74769662 GRCh37]
ENST00000555904 [Chr.14(-): 74752987-74755471 GRCh37]
ENST00000556119 [Chr.14(-): 74759015-74769619 GRCh37]
ENST00000556517 [Chr.14(-): 74753100-74757155 GRCh37]
ENST00000556971 [Chr.14(-): 74759534-74769613 GRCh37]
ENST00000557554 [Chr.14(-): 74757050-74769700 GRCh37]
ENST00000557588 [Chr.14(-): 74759478-74769690 GRCh37]
Annotation History:View Events (162)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for ABCD4.

Variant Data

View all PMT variants for ABCD4 on UCSC Genome Browser
Showing SNP features for transcript:   
ABCD4 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:ABCD4 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
74770097 GRCh37
73839850 NCBI36
-330-482
GGCAAGACCCCGCCTTTACAAAAGA C → T AAAAGCATTAGCCGGGGATGGTGGC
+ 
 
n=
C/C=
C/T=
T/T=
T=
132
63
3
0
0.023
134
67
0
0
0.000
134
67
0
0
0.000
132
65
1
0
0.008
PMT-272
 PDE
74770083 GRCh37
73839836 NCBI36
-316-468
AGCCTGGGCAACATGGCAAGACCCC G → A CCTTTACAAAAGACAAAAGCATTAG
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
66
0
0
0.000
134
66
1
0
0.007
136
68
0
0
0.000
132
65
1
0
0.008
PMT-272
PromoterPDE
74770006 GRCh37
73839759 NCBI36
-239-391
CGGTGGGTTACTCCTGTAATCCCAG C → A ACTTTGGAAGGCCAAGGCGGGAGGA
+ 
 
n=
C/C=
C/A=
A/A=
A=
132
62
4
0
0.030
134
67
0
0
0.000
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
PromoterPDE
74769980 GRCh37
73839733 NCBI36
-213-365
GTATAAATTAGGCTTCCAGCCGGGC C → G CGGTGGGTTACTCCTGTAATCCCAG
+ 
 
n=
C/C=
C/G=
G/G=
G=
132
63
3
0
0.023
134
67
0
0
0.000
136
68
0
0
0.000
132
65
1
0
0.008
PMT-272
PromoterPDE
74769977 GRCh37
73839730 NCBI36
-210-362
AAAGTATAAATTAGGCTTCCAGCCG G → A GCCCGGTGGGTTACTCCTGTAATCC
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
47
17
2
0.159
134
26
35
6
0.351
136
43
22
3
0.206
132
36
25
5
0.265
PMT-272
PromoterPDE
74769899 GRCh37
73839652 NCBI36
-132-284
TTTATGGCAAGTATTTTAGATTCTG T → A GTATAATAGATGTTTTACATATTCT
+ 
 
n=
T/T=
T/A=
A/A=
A=
132
63
3
0
0.023
134
67
0
0
0.000
136
68
0
0
0.000
132
65
1
0
0.008
PMT-272
PromoterPDE
74769851 GRCh37
73839604 NCBI36
-84-236
TTCTGGGAGACTTCCCTTTTGACAA T → C AGGTATCCGAGAGTGTAACTACTTT
+ 
 
n=
T/T=
T/C=
C/C=
C=
132
66
0
0
0.000
134
66
1
0
0.007
136
67
1
0
0.007
132
60
5
1
0.053
PMT-272
PromoterPDE
74769841 GRCh37
73839594 NCBI36
-74-226
CCCCCATATTTTCTGGGAGACTTCC C → T TTTTGACAATAGGTATCCGAGAGTG
+ 
 
n=
C/C=
C/T=
T/T=
T=
132
47
17
2
0.159
134
26
35
6
0.351
136
43
22
3
0.206
132
36
25
5
0.265
PMT-272
Exon 1: 5UTR
Promoter
PDE
74769736 GRCh37
73839489 NCBI36
32-121
GCGTTTGATAGAGAGGAAGGTGCGG G → C AGACGCGGACTCTCCCGGAAGCGAC
+ 
 
n=
G/G=
G/C=
C/C=
C=
132
63
3
0
0.023
134
67
0
0
0.000
136
68
0
0
0.000
132
65
1
0
0.008
PMT-272
Exon 1: 5UTR
Promoter
PDE
74769730 GRCh37
73839483 NCBI36
38-115
GAGACGGCGTTTGATAGAGAGGAAG G → A TGCGGGAGACGCGGACTCTCCCGGA
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
65
1
0
0.008
134
62
5
0
0.037
136
68
0
0
0.000
132
61
5
0
0.038
PMT-272
Exon 1: CodingPDE
74769607 GRCh37
73839360 NCBI36
1619
CGCCAGCTCCGGGCGCGGGCCCCGC G → C ACCGCCATGACCTGAGACCCGAGGG
+3
Val = Val
n=
G/G=
G/C=
C/C=
C=
132
64
2
0
0.015
134
67
0
0
0.000
136
68
0
0
0.000
130
65
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.