UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:ABC38
HGNC Symbol:ABCE1
HGNC Description:ATP-binding cassette, sub-family E (OABP), member 1
HGNC ID:69
Superfamily:ABC
Chromosome:Chr.4(+): 146019156-146050676 GRCh37
Location:4q31
OMIM:601213
OMIM Phenotype:None
Accessions:X76388
Nucleotide RefSeq:NM_001040876
Protein RefSeq:NP_001035809
Entrez:6059
Ensembl:ENSG00000164163
Isoforms:2
Evidence:Substrate In Vitro Evidence: 1. RLI (RNase L inhibitor) expression is not regulated by interferon action. RLI expression in reticulocyte extracts antagonizes the 2-5A binding ability and the nuclease activity of endogenous RNase L. The overexpression of RLI in HeLa cells inhibits IFN activity on encephalomyocarditis. RLI is the first described mediator of the 2-5A/RNase L pathway. Bisbal, C et al. JBC 1995 Jun 2, 270(22):13308-17 PMID 7539425. 2. RLI is induced during HIV-1 infection and downregulates the 2-5A/RNase L pathway in human T cells, leading to an increase in HIV replication. RLI antisense cDNA-expressing clones reverse the inhibition of RNase L activity and leads to a decrease in viral load. Martinand, C et al. J Virol 1999 Jan, 73(1):290-6 PMID 9847332. 3. RLI is transiently induced by dsRNA. Martinand, C et al. J Interferon Cytokine Res 1998 Dec, 18(12):1031-8 PMID 9877446. Tissue Distribution Evidence: 1. Northern blot shows ubiquitous expression of two transcript forms but differences in levels of expression suggest a tissue-specific regulation. Aubry, F et al. FEBS Lett 1996 Feb 26, 381(1-2):135-9 PMID 8641422.
Tissues:ubiquitous
Type:protein-coding
Sets:0
PharmGKB ID:PA24404
HPRD ID:03132
Substrates:(RNase L inhibitor)
Trivial Names:RLI, OABP, ABC38, RNS4I, RNASEL1, RNASELI
Transcripts:NM_001040876.1 [Chr.4(+): 146019156-146050676 GRCh37]
NM_002940.2 [Chr.4(+): 146019156-146050676 GRCh37]
ENST00000296577 [Chr.4(+): 146019084-146050331 GRCh37]
ENST00000502586 [Chr.4(+): 146019440-146032136 GRCh37]
ENST00000502803 [Chr.4(+): 146019463-146044457 GRCh37]
ENST00000504292 [Chr.4(+): 146029179-146038567 GRCh37]
ENST00000504683 [Chr.4(+): 146044021-146048795 GRCh37]
ENST00000506506 [Chr.4(+): 146019466-146044690 GRCh37]
ENST00000507193 [Chr.4(+): 146019463-146048725 GRCh37]
ENST00000509593 [Chr.4(+): 146042186-146044479 GRCh37]
ENST00000510321 [Chr.4(+): 146042472-146045083 GRCh37]
ENST00000515678 [Chr.4(+): 146042162-146044842 GRCh37]

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for ABCE1.

Variant Data

View all PMT variants for ABCE1 on UCSC Genome Browser
Showing SNP features for transcript:   
ABCE1 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:ABCE1 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
146018790 GRCh37
146238240 NCBI36
-366-6775
TTAAACGCTCAATAAGTAATTTACT G → T AATGAATAAACAGATGAATAGGTTC
+ 
 
n=
G/G=
G/T=
T/T=
T=
124
59
3
0
0.024
98
49
0
0
0.000
124
62
0
0
0.000
116
58
0
0
0.000
PMT-272
 PDE
146018819 GRCh37
146238269 NCBI36
-337-6746
GAATAAACAGATGAATAGGTTCAGT C → T ATGAACTAGTTGTCACTTGCCTGCA
+ 
 
n=
C/C=
C/T=
T/T=
T=
124
59
3
0
0.024
98
49
0
0
0.000
124
62
0
0
0.000
116
58
0
0
0.000
PMT-272
Promoter
Exon 1: 5UTR
PDE
146019171 GRCh37
146238621 NCBI36
16-6394
GCTCCACTCCTGACCCACCGGCCTT G → A AGGAAAGCGCAAACGTAAAAAAAGA
+ 
 
n=
G/G=
G/A=
A/A=
A=
124
61
1
0
0.008
98
49
0
0
0.000
124
62
0
0
0.000
116
58
0
0
0.000
PMT-272
Promoter
Exon 1: 5UTR
PDE
146019190 GRCh37
146238640 NCBI36
35-6375
GGCCTTGAGGAAAGCGCAAACGTAA A → G AAAAGATTGAAACCGGAGAGGCGAA
+ 
 
n=
A/A=
A/G=
G/G=
G=
124
61
1
0
0.008
98
49
0
0
0.000
124
62
0
0
0.000
116
58
0
0
0.000
PMT-272

Transmembrane prediction: TOPO2 image is not available.