UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:ABC28
HGNC Symbol:ABCF2
HGNC Description:ATP-binding cassette, sub-family F (GCN20), member 2
HGNC ID:71
Superfamily:ABC
Chromosome:Chr.7(-): 150904923-150924460 GRCh37
Location:7q36
OMIM:612510
OMIM Phenotype:None
Accessions:AF261091,AL050291
Nucleotide RefSeq:NM_005692
Protein RefSeq:NP_005683
Entrez:10061
Ensembl:ENSG00000033050
Isoforms:3
Evidence:Tissue Distribution Evidence: Ubiquitous (located on mitochondria) - Northern blot. Hogue DL, et al. J Mol Biol. 1999 Jan 8;285(1):379-89. Testis, Trachea, Lung, Uterus > Placenta, Prostate, Spleen - TaqMan RT-PCR. Langmann T, et al. Clinical Chemistry. 2003; 49: 230-8.
Tissues:Ubiquitous
Type:protein-coding
Sets:0
PharmGKB ID:PA24406
HPRD ID:12403
Substrates:No data
Trivial Names:ABC28, HUSSY18, HUSSY-18, EST133090
Transcripts:NM_005692.4 [Chr.7(-): 150904923-150924460 GRCh37]
NM_007189.2 [Chr.7(-): 150908570-150924460 GRCh37]
XM_005249931.1 [Chr.7(-): 150904923-150924116 GRCh37]
ENST00000222388 [Chr.7(-): 150904923-150924252 GRCh37]
ENST00000287844 [Chr.7(-): 150909576-150924316 GRCh37]
ENST00000441774 [Chr.7(-): 150920766-150924121 GRCh37]
ENST00000468073 [Chr.7(-): 150918722-150923712 GRCh37]
ENST00000473874 [Chr.7(-): 150915246-150919070 GRCh37]
ENST00000477252 [Chr.7(-): 150923559-150924044 GRCh37]
Annotation History:View Events (20)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for ABCF2.

Variant Data

View all PMT variants for ABCF2 on UCSC Genome Browser
Showing SNP features for transcript:   
ABCF2 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:ABCF2 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
150924740 GRCh37
150555673 NCBI36
-280-1196
CGAAACAATGGGAGAGGAGAGGTGG G → A AGCGTGAGGGGAGGACTAAAATGAA
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
59
7
0
0.053
134
62
5
0
0.037
134
53
13
1
0.112
132
54
12
0
0.091
PMT-272
PromoterPDE
150924647 GRCh37
150555580 NCBI36
-187-1103
TGTTGTGGAGTTACGAGTTTTTAGA G → A CTACCTAACCGACTCAGGCAGCAGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
66
0
0
0.000
134
67
0
0
0.000
134
64
3
0
0.022
132
66
0
0
0.000
PMT-272
PromoterPDE
150924555 GRCh37
150555488 NCBI36
-95-1011
TCGGGCGCTGGAAACTGCAAATCCC A → G GATTGCTCGTTGGATAAACCGGCTG
+ 
 
n=
A/A=
A/G=
G/G=
G=
132
66
0
0
0.000
134
67
0
0
0.000
134
67
0
0
0.000
132
65
1
0
0.008
PMT-272
PromoterPDE
150924470 GRCh37
150555403 NCBI36
-10-926
GGGGCCGCGTGACGCCATCAGGATG C → A GCGAGGCTCGGGGAGGGGGCGGGAT
+ 
 
n=
C/C=
C/A=
A/A=
A=
132
66
0
0
0.000
134
67
0
0
0.000
134
67
0
0
0.000
132
65
1
0
0.008
PMT-272
Exon 1: 5UTRPDE
150924367 GRCh37
150555300 NCBI36
94-823
TTCTCGGCGCGCCGCGCTGCCTCCT T → C GGAAGTGTAGTCCTCAAGTTGCAGC
+ 
 
n=
T/T=
T/C=
C/C=
C=
132
65
1
0
0.008
134
67
0
0
0.000
134
67
0
0
0.000
132
66
0
0
0.000
PMT-272

Transmembrane prediction: TOPO2 image is not available.