UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:ABCF3
HGNC Symbol:ABCF3
HGNC Description:ATP-binding cassette, sub-family F (GCN20), member 3
HGNC ID:72
Superfamily:ABC
Chromosome:Chr.3(+): 183903863-183911795 GRCh37
Location:3q27.1
OMIM:
OMIM Phenotype:None
Accessions:AK002060
Nucleotide RefSeq:NM_018358
Protein RefSeq:NP_060828
Entrez:55324
Ensembl:ENSG00000161204
Isoforms:3
Evidence:Tissue Distribution Evidence: Lung, Adrenal Gland > Prostate > Placenta, Trachea, Testis, Spleen, Uterus - TaqMan RT-PCR. Langmann T, et al. Clinical Chemistry. 2003; 49: 230-8.
Tissues:Lung, Adrenal Gland > Prostate > Placenta, Trachea, Testis, Spleen, Uterus
Type:protein-coding
Sets:0
PharmGKB ID:PA24407
HPRD ID:12404
Substrates:No data
Trivial Names:EST201864
Transcripts:NM_018358.2 [Chr.3(+): 183903863-183911795 GRCh37]
XM_005247581.1 [Chr.3(+): 183903892-183911795 GRCh37]
XM_005247580.1 [Chr.3(+): 183903962-183911795 GRCh37]
ENST00000292808 [Chr.3(+): 183903962-183911793 GRCh37]
ENST00000421340 [Chr.3(+): 183903883-183905746 GRCh37]
ENST00000429586 [Chr.3(+): 183903811-183911795 GRCh37]
ENST00000463685 [Chr.3(+): 183903948-183904834 GRCh37]
ENST00000466416 [Chr.3(+): 183903987-183905446 GRCh37]
ENST00000466742 [Chr.3(+): 183907618-183911794 GRCh37]
ENST00000468892 [Chr.3(+): 183907421-183911790 GRCh37]
ENST00000471226 [Chr.3(+): 183906102-183907513 GRCh37]
ENST00000472608 [Chr.3(+): 183906122-183907747 GRCh37]
ENST00000473311 [Chr.3(+): 183903964-183911800 GRCh37]
ENST00000475728 [Chr.3(+): 183906578-183907489 GRCh37]
ENST00000478288 [Chr.3(+): 183903949-183905689 GRCh37]
ENST00000480539 [Chr.3(+): 183910938-183911557 GRCh37]
ENST00000480562 [Chr.3(+): 183908652-183911794 GRCh37]
ENST00000481116 [Chr.3(+): 183903979-183905401 GRCh37]
ENST00000485921 [Chr.3(+): 183903892-183905071 GRCh37]
ENST00000489719 [Chr.3(+): 183906597-183907668 GRCh37]
ENST00000498136 [Chr.3(+): 183903984-183906615 GRCh37]
Annotation History:View Events (19)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for ABCF3.

Variant Data

View all PMT variants for ABCF3 on UCSC Genome Browser
Showing SNP features for transcript:   
ABCF3 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:ABCF3 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
PromoterPDE
183903660 GRCh37
185386354 NCBI36
-203-336
CTCCCACCCGCCAGACCACGGGTGC C → G TCGCGGCCCCGATAAACCTTGAGCT
+ 
 
n=
C/C=
C/G=
G/G=
G=
130
60
3
2
0.054
130
65
0
0
0.000
130
65
0
0
0.000
130
64
1
0
0.008
PMT-272
PromoterPDE
183903799 GRCh37
185386493 NCBI36
-64-197
AGGTGTCGCGCACGCGCAGAGAGCG C → T GGCTCCGGCGCAGACTCGGCGCCTC
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
65
0
0
0.000
132
66
0
0
0.000
136
65
1
2
0.037
132
66
0
0
0.000
PMT-272
Exon 1: 5UTRPDE
183903937 GRCh37
185386631 NCBI36
75-59
AGGGCGAGATTTCGGGGGCAGGGCG G → GC GGGGCGGGCCTAGGCCGGGGTCTCA
+ 
 
n=
G/G=
G/GC=
GC/GC=
GC=
130
60
2
3
0.062
130
49
6
10
0.200
134
67
0
0
0.000
128
52
5
7
0.148
PMT-272
Exon 1: 5UTRPDE
183903941 GRCh37
185386635 NCBI36
79-55
CGAGATTTCGGGGGCAGGGCGGGGG G → GG CGGGCCTAGGCCGGGGTCTCACAGC
+ 
 
n=
G/G=
G/GG=
GG/GG=
GG=
130
52
4
9
0.169
130
59
0
6
0.092
134
37
0
30
0.448
128
55
0
9
0.141
PMT-272
Exon 1: 5UTRPDE
183903985 GRCh37
185386679 NCBI36
123-11
TCACAGCGACTGCGCGGACGGGTTC C → T TGAGTGGAACATGGCGACTTGCGCC
+ 
 
n=
C/C=
C/T=
T/T=
T=
120
60
0
0
0.000
118
59
0
0
0.000
132
65
0
1
0.015
118
59
0
0
0.000
PMT-272
Exon 1: CodingPDE
183904031 GRCh37
185386725 NCBI36
16936
GCGCCGAAATCCTGCGGAGCGAGTT C → T CCCGAAATTGACGGACAAGTCTTCG
+12
Phe = Phe
n=
C/C=
C/T=
T/T=
T=
118
58
0
1
0.017
116
58
0
0
0.000
132
66
0
0
0.000
118
59
0
0
0.000
PMT-272

Transmembrane prediction: TOPO2 image is not available.