UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:ABC8
HGNC Symbol:ABCG1
HGNC Description:ATP-binding cassette, sub-family G (WHITE), member 1
HGNC ID:73
Superfamily:ABC
Chromosome:Chr.21(+): 43619799-43724497 GRCh37
Location:21q22.3
OMIM:603076
OMIM Phenotype:None
Accessions:NM_004915
Nucleotide RefSeq:NM_004915
Protein RefSeq:NP_004906
Entrez:9619
Ensembl:ENSG00000160179
Isoforms:7
Evidence:Substrate In Vitro Evidence: Cholesterol 1. Lipid-loaded macrophages. PNAS. 2000; 97: 817-22. Substrate In Vivo Evidence: Cholesterol 1. ABCG1 adenovirus expression in mice. Ito T. Drug News Perspect. 2003; 16: 490-2. Tissue Distribution Evidence: Lung and Spleen 1. TaqMan RT-PCR. Langmann T. Clinical Chemistry. 2003; 49: 230-8. Macrophages (lipid-loaded) 1. mRNA differential display. JBC. 2000; 275:14700-7.
Tissues:Lung, Spleen, Macrophages
Type:protein-coding
Sets:V
PharmGKB ID:PA24408
HPRD ID:04355
Substrates:Cholesterol
Trivial Names:ABC8, WHITE1
Transcripts:NM_004915.3 [Chr.21(+): 43639267-43717354 GRCh37]
NM_016818.2 [Chr.21(+): 43639267-43717354 GRCh37]
NM_207174.1 [Chr.21(+): 43640008-43717354 GRCh37]
NM_207627.1 [Chr.21(+): 43619799-43717354 GRCh37]
NM_207628.1 [Chr.21(+): 43619922-43717354 GRCh37]
NM_207629.1 [Chr.21(+): 43636187-43717354 GRCh37]
XM_005261209.1 [Chr.21(+): 43639931-43724497 GRCh37]
ENST00000340588 [Chr.21(+): 43676459-43717352 GRCh37]
ENST00000343687 [Chr.21(+): 43639931-43717354 GRCh37]
ENST00000347800 [Chr.21(+): 43636187-43717354 GRCh37]
ENST00000361802 [Chr.21(+): 43639228-43717354 GRCh37]
ENST00000398437 [Chr.21(+): 43676194-43717354 GRCh37]
ENST00000398449 [Chr.21(+): 43639228-43717354 GRCh37]
ENST00000398457 [Chr.21(+): 43619799-43717354 GRCh37]
ENST00000450121 [Chr.21(+): 43639227-43704758 GRCh37]
ENST00000462050 [Chr.21(+): 43619922-43717354 GRCh37]
ENST00000467818 [Chr.21(+): 43696796-43706251 GRCh37]
ENST00000472587 [Chr.21(+): 43696454-43717354 GRCh37]
ENST00000496783 [Chr.21(+): 43706044-43715462 GRCh37]
Annotation History:View Events (19)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for ABCG1.

Variant Data

View all PMT variants for ABCG1 on UCSC Genome Browser
Showing SNP features for transcript:   
ABCG1 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:ABCG1 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE3 pubsI
43619665 GRCh37
42492734 NCBI36
-19602-19708
GTGCTGCTTTACGCCCAGTGACTTG T → G GAGGGAACAGAACTGCCCTTTAGTA
+ 
 
n=
T/T=
T/G=
G/G=
G=
136
11
28
29
0.632
136
37
30
1
0.235
136
24
33
11
0.404
136
30
27
11
0.360
PMT-272
 PDE
43619695 GRCh37
42492764 NCBI36
-19572-19678
GAACAGAACTGCCCTTTAGTAACCC T → C GCTCACTTCCTGTTTTCTGCAGTAA
+ 
 
n=
T/T=
T/C=
C/C=
C=
136
67
1
0
0.007
136
56
11
1
0.096
136
68
0
0
0.000
136
63
5
0
0.037
PMT-272
 PDE1 pubI
43638855 GRCh37
42511924 NCBI36
-412-518
GGCGGGAAGGGAAGAAGCAGCAGCA A → G GAAAGAAGCCCCCTGGCCCTCACTC
+ 
 
n=
A/A=
A/G=
G/G=
G=
130
64
1
0
0.008
118
46
11
2
0.127
132
49
15
2
0.144
122
49
12
0
0.098
PMT-272
 PDE
43638949 GRCh37
42512018 NCBI36
-318-424
TTGAGGCTTGGAGGCAGTGGATTTC C → T GAGCCTGGGAACCCCGGCGTCTGTC
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
62
3
0
0.023
118
59
0
0
0.000
132
66
0
0
0.000
122
61
0
0
0.000
PMT-272
 PDE
43639009 GRCh37
42512078 NCBI36
-258-364
CGCAGCCTCACCCGTGCTGGCCCAG C → T CCCCGCGAGTTCGGGACCCGGGGTT
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
65
0
0
0.000
118
59
0
0
0.000
132
66
0
0
0.000
122
60
1
0
0.008
PMT-272
PromoterPDE4 pubs
43639018 GRCh37
42512087 NCBI36
-249-355
ACCCGTGCTGGCCCAGCCCCCGCGA G → A TTCGGGACCCGGGGTTTCCGGGGTG
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
57
3
5
0.100
118
42
11
6
0.195
132
38
10
18
0.348
122
35
17
9
0.287
PMT-272
PromoterPDE
43639028 GRCh37
42512097 NCBI36
-239-345
GCCCAGCCCCCGCGAGTTCGGGACC C → T GGGGTTTCCGGGGTGGCAGGGGGTT
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
65
0
0
0.000
118
59
0
0
0.000
132
66
0
0
0.000
122
60
1
0
0.008
PMT-272
PromoterPDE
43639161 GRCh37
42512230 NCBI36
-106-212
GCAAAACAAGAGCACGCGCACCTGC C → T GGCCCGCCCGCCCCCTTGGTGCCGG
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
65
0
0
0.000
118
59
0
0
0.000
132
65
1
0
0.008
122
61
0
0
0.000
PMT-272
PromoterPDE
43639168 GRCh37
42512237 NCBI36
-99-205
AAGAGCACGCGCACCTGCCGGCCCG C → A CCGCCCCCTTGGTGCCGGCCAATCG
+ 
 
n=
C/C=
C/A=
A/A=
A=
130
64
1
0
0.008
118
51
8
0
0.068
132
66
0
0
0.000
122
57
4
0
0.033
PMT-272
PromoterPDE
43639250 GRCh37
42512319 NCBI36
-17-123
CCAGAGCCGGAGCCGGATCCCAGCC G → C GAGCCCAAGCGCAGCCCGCACCCCG
+ 
 
n=
G/G=
G/C=
C/C=
C=
130
64
1
0
0.008
118
59
0
0
0.000
132
66
0
0
0.000
122
61
0
0
0.000
PMT-272
 PDEI
43716241 GRCh37
42589310 NCBI36
  
GCCAACGGCGTGGCTGGCTGGGAGA A → G CGTCCTCCCTCATGCCTGGCCTTTC
+ 
 
n=
A/A=
A/G=
G/G=
G=
136
29
27
12
0.375
136
68
0
0
0.000
134
67
0
0
0.000
132
63
3
0
0.023
PMT-272
 PDE
43716242 GRCh37
42589311 NCBI36
  
CCAACGGCGTGGCTGGCTGGGAGAA C → T GTCCTCCCTCATGCCTGGCCTTTCC
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
68
0
0
0.000
136
67
1
0
0.007
134
67
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 15: CodingPDE
43716349 GRCh37
42589418 NCBI36
19901884
ATCTGCACTGTGACATCGACGAGAC G → A TGCCACTTCCAGAAGTCGGAGGCCA
+628
Thr = Thr
n=
G/G=
G/A=
A/A=
A=
136
67
1
0
0.007
136
68
0
0
0.000
134
67
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 15: 3UTRPDE
43716548 GRCh37
42589617 NCBI36
2189 
CAGGAAGATTAGACACTGTGGCCGA G → C GGCACGTCTAGAATCGAGGAGGCAA
+ 
 
n=
G/G=
G/C=
C/C=
C=
136
68
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
132
65
1
0
0.008
PMT-272
Exon 15: 3UTRPDE
43716554 GRCh37
42589623 NCBI36
2195 
GATTAGACACTGTGGCCGAGGGCAC G → A TCTAGAATCGAGGAGGCAAGCCTGT
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
66
2
0
0.015
136
66
2
0
0.015
134
67
0
0
0.000
132
48
17
1
0.144
PMT-272
Exon 15: 3UTRPDE
43716558 GRCh37
42589627 NCBI36
2199 
AGACACTGTGGCCGAGGGCACGTCT A → G GAATCGAGGAGGCAAGCCTGTGCCC
+ 
 
n=
A/A=
A/G=
G/G=
G=
136
67
1
0
0.007
136
68
0
0
0.000
134
67
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 15: 3UTRPDE
43716583 GRCh37
42589652 NCBI36
2224 
AGAATCGAGGAGGCAAGCCTGTGCC C → T GACCGACGACACAGAGACTCTTCTG
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
68
0
0
0.000
136
66
2
0
0.015
134
67
0
0
0.000
132
65
1
0
0.008
PMT-272
Exon 15: 3UTRPDE
43716588 GRCh37
42589657 NCBI36
2229 
CGAGGAGGCAAGCCTGTGCCCGACC G → A ACGACACAGAGACTCTTCTGATCCA
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
65
3
0
0.022
136
68
0
0
0.000
134
67
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 15: 3UTRPDE
43716648 GRCh37
42589717 NCBI36
2289 
ACCGCGTTGGGTTTGTGGGTGTCTC G → A TGCTCAGCCACTCTGCCCAGCTGGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
68
0
0
0.000
136
68
0
0
0.000
134
65
2
0
0.015
132
66
0
0
0.000
PMT-272
Exon 15: 3UTRPDE
43716653 GRCh37
42589722 NCBI36
2294 
GTTGGGTTTGTGGGTGTCTCGTGCT C → A AGCCACTCTGCCCAGCTGGGTTGGA
+ 
 
n=
C/C=
C/A=
A/A=
A=
136
68
0
0
0.000
136
68
0
0
0.000
134
66
1
0
0.007
132
66
0
0
0.000
PMT-272
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
Exon 15: 3UTRPDE3 pubsI
43716901 GRCh37
42589970 NCBI36
2542 
AAGCAGCCTCTCAGCTGATGGCTGC A → G CAGTCAGATGTCTGGTGGCAGAGAG
+ 
 
n=
A/A=
A/G=
G/G=
G=
136
13
31
24
0.581
134
12
32
23
0.582
130
17
28
20
0.523
132
18
30
18
0.500
PMT-272
Exon 15: 3UTRPDE
43717178 GRCh37
42590247 NCBI36
2819 
TCATACATAGACAGCACTTGTGAAG G → A ATTGAATGCAGGTTCCAGGTGGAGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
68
0
0
0.000
134
67
0
0
0.000
130
64
1
0
0.008
132
66
0
0
0.000
PMT-272
 PDE
43717409 GRCh37
42590478 NCBI36
  
TTGATTTAAACAAACAAACAAACAG C → T TTCCCTTTCCTCCTGTATCACCTCA
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
44
20
4
0.206
134
62
5
0
0.037
130
65
0
0
0.000
132
61
5
0
0.038
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.