UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:MXR
HGNC Symbol:ABCG2
HGNC Description:ATP-binding cassette, sub-family G (WHITE), member 2
HGNC ID:74
Superfamily:ABC
Chromosome:Chr.4(-): 89011416-89152569 GRCh37
Location:4q22
OMIM:603756
OMIM Phenotype:None
Accessions:AF103796
Nucleotide RefSeq:NM_004827
Protein RefSeq:NP_004818
Entrez:9429
Ensembl:ENSG00000118777
Isoforms:5
Evidence:Substrate In Vitro Evidence: 1. Wild-type MXR, two mutant variants found in drug-selected tumor cells (R482 G and R482T), and a catalytic center mutant (K86M) were expressed in Sf9 insect cells. The K86M was not functional. Wild-type and the R482 mutants transported mitoxantrone and Hoechst 33342; only the R482 mutants transported Rho123. MXR-specific transport was inhibited by fumitremorgin C. Ozvegy, C et al. JBC 2002 Dec 13, 277(50):47980-90 PMID 12374800. 2. Wild-type MXR and the R482T mutant were introduced to MCF7 cells. Both transfectants showed strong resistance to indolocarbazoles. The indolocarbazole compound A was transported by membrane vesicles. This transport was inhibited by another indocarbazole compound, but not by mitoxantrone. Nakagawa, R et al. Biochem Biophys Res Comm 2002 Dec 13, 299(4):669-75 PMID 12459192. 3. SN-38-selected PC-6/SN2-5H human lung carcinoma cells overexpress MXR. Membrane vesicles from these cells transported SN-38 and SN-38-glucuronide. Nakatoni, K et al. Biochem Biophys Res Comm 2001 Nov 9, 288(4):827-32 PMID 11688982. 4. When overexpressed in cell lines, MXR confers high levels of resistance to anthracyclines, mitoxantrone, bisantrene, and the camptothecins topotecan and SN-38. Ejendal, KR; Hrycyna, CA. Curr Prot Pept Sci 2002 Oct, 3(5):503-11 PMID 12369998. Substrate In Vivo Evidence: 1. MXR may play a role in MDR in acute myeloid leukemia. Ejendal, KR; Hrycyna, CA. Curr Prot Pept Sci 2002 Oct, 3(5):503-11 PMID 12369998. Tissue Distribution Evidence: 1. IHC demonstrated MXR expression at the blood-brain barrier (the luminal surface of microvessel endothelium). Cooray, HC et al. Neuroreport 2002 Nov 15, 13(16):2059-63 PMID 12438926. 2. RT-PCR showed that MXR expression varied widely in breast cancer cell lines and in primary breast carcinomas. There was no indication that elevated MXR expression in breast carcinomas confers resistance to anthracyclines. Faneyte, IF et al. Clin Cancer Res 2002 Apr, 8(4):1068-74 PMI 11948115. 3. MXR is abundantly expressed in placenta, liver, intestine, and stem cells. Ejendal, KR; Hrycyna, CA. Curr Prot Pept Sci 2002 Oct, 3(5):503-11 PMID 12369998.
Tissues:blood-brain barrier, placenta, liver, intestine, stem cells
Type:protein-coding
Sets:II,IV
PharmGKB ID:PA390
HPRD ID:04783
Substrates:antrancyclines, mitoxantrone, bisantrene, topotecan, SN-38
Trivial Names:MRX, MXR, ABCP, BCRP, BMDP, MXR1, ABC15, BCRP1, CD338, GOUT1, CDw338, UAQTL1, EST157481
Transcripts:NM_004827.2 [Chr.4(-): 89011416-89080011 GRCh37]
NM_001257386.1 [Chr.4(-): 89011416-89152474 GRCh37]
XM_005263355.1 [Chr.4(-): 89011421-89152569 GRCh37]
XM_005263354.1 [Chr.4(-): 89011421-89080045 GRCh37]
XM_005263356.1 [Chr.4(-): 89011421-89079737 GRCh37]
ENST00000237612 [Chr.4(-): 89011421-89080064 GRCh37]
ENST00000503830 [Chr.4(-): 89052996-89080391 GRCh37]
ENST00000505480 [Chr.4(-): 89052996-89079823 GRCh37]
ENST00000515655 [Chr.4(-): 89011416-89152474 GRCh37]
Annotation History:View Events (35)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for ABCG2.

Variant Data

View all PMT variants for ABCG2 on UCSC Genome Browser
Showing SNP features for transcript:   
ABCG2 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:ABCG2 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 PDE
89080495 GRCh37
89299519 NCBI36
-484-19348
GGCGCAAGCATCCACTTTCTCAGAA T → A CCCATTCACCAGAAACCACCCATTT
- 
 
n=
T/T=
T/A=
A/A=
A=
120
55
5
0
0.042
92
46
0
0
0.000
130
65
0
0
0.000
116
58
0
0
0.000
n/a
0.000
PMT-272
 PDE
89080494 GRCh37
89299518 NCBI36
-483-19347
GCGCAAGCATCCACTTTCTCAGAAT C → T CCATTCACCAGAAACCACCCATTTA
- 
 
n=
C/C=
C/T=
T/T=
T=
120
60
0
0
0.000
92
46
0
0
0.000
130
64
1
0
0.008
116
58
0
0
0.000
n/a
0.000
PMT-272
 PDE
89080435 GRCh37
89299459 NCBI36
-424-19288
TGGGTGCGAGCAGCGCTTGTGACTG G → A GCAACCTGTGCGTCAGCGTCCCCGG
- 
 
n=
G/G=
G/A=
A/A=
A=
120
60
0
0
0.000
92
46
0
0
0.000
130
65
0
0
0.000
116
57
1
0
0.009
n/a
0.000
PMT-272
 PDE
89080401 GRCh37
89299425 NCBI36
-390-19254
TGCGTCAGCGTCCCCGGTGCTTCGG C → A GCTCCGGCCAGTGACGGCGACCAAA
- 
 
n=
C/C=
C/A=
A/A=
A=
120
51
9
0
0.075
92
46
0
0
0.000
130
65
0
0
0.000
116
56
2
0
0.017
n/a
0.000
PMT-272
 PDEI
89080351 GRCh37
89299375 NCBI36
-340-19204
ACCCAGCTAGGTCAGACGAGGTACT G → C ATCAGCCCAATGAGCGCCTGGTGAT
- 
 
n=
G/G=
G/C=
C/C=
C=
120
57
3
0
0.025
92
40
6
0
0.065
130
65
0
0
0.000
116
52
5
1
0.060
n/a
0.000
PMT-272
 PDE
89080277 GRCh37
89299301 NCBI36
-266-19130
CATTCCGTTCGATCCCGGAGGCGGG ATTTGTG → - GGCTTGTCCCTGCGTGTCA
- 
 
n=
ATTTGTG/ATTTGTG=
ATTTGTG/-=
-/-=
-=
130
60
5
0
0.038
96
45
2
1
0.042
130
65
0
0
0.000
128
58
6
0
0.047
n/a
0.000
PMT-272
PromoterPDE
89080162 GRCh37
89299186 NCBI36
-151-19015
CAGGACACGTGTGCGCTTTCAGCCG G → C GTCGCAGGGCGCTTATCGCGGCCCG
- 
 
n=
G/G=
G/C=
C/C=
C=
130
65
0
0
0.000
96
48
0
0
0.000
130
65
0
0
0.000
128
63
1
0
0.008
n/a
0.000
PMT-272
PromoterPDE
89080095 GRCh37
89299119 NCBI36
-84-18948
CTCACCCCCGCCCGCGAACCCCGAC C → T TGGGGAAACCCGGGGCGCTGGGGAG
- 
 
n=
C/C=
C/T=
T/T=
T=
130
65
0
0
0.000
96
48
0
0
0.000
130
64
1
0
0.008
128
64
0
0
0.000
n/a
0.000
PMT-272
Exon 1: 5UTR
Promoter
PDE
89079994 GRCh37
89299018 NCBI36
18-18847
AAGTTCGTGTCAGCGCTGCCTGAGC T → C CGTCCCCTGGATGTCCGGGTCTCCC
- 
 
n=
T/T=
T/C=
C/C=
C=
130
61
4
0
0.031
96
45
2
1
0.042
130
65
0
0
0.000
128
58
6
0
0.047
n/a
0.000
PMT-272
Exon 1: 5UTRPDE
89079940 GRCh37
89298964 NCBI36
72-18793
GCGGCCACCCGCCGGCTCCCATCGT G → A ACCTCCAGCCGCAGCGCCTCCCACG
- 
 
n=
G/G=
G/A=
A/A=
A=
130
65
0
0
0.000
96
48
0
0
0.000
130
64
1
0
0.008
128
64
0
0
0.000
n/a
0.000
PMT-272
Exon 1: 5UTRPDE
89079780 GRCh37
89298804 NCBI36
232-18633
AGGAGGGAAGAGGCAGTGCCCGCCA C → T TCCCACTGAGATTGAGAGACGCGGC
- 
 
n=
C/C=
C/T=
T/T=
T=
136
68
0
0
0.000
136
67
1
0
0.007
136
67
1
0
0.007
136
68
0
0
0.000
n/a
0.000
PMT-272
Exon 1: 5UTRPDE
89079647 GRCh37
89298671 NCBI36
365-18500
CTGCTTTAGAGTTTGTTTGGAAGGT C → T CGGGTGACTCATCCCAACATTTACA
- 
 
n=
C/C=
C/T=
T/T=
T=
136
68
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
n/a
0.000
PMT-272
Exon 1: 5UTRPDE
89079632 GRCh37
89298656 NCBI36
380-18485
TTTGGAAGGTCCGGGTGACTCATCC C → T AACATTTACATCCTTAATTGTTAAA
- 
 
n=
C/C=
C/T=
T/T=
T=
136
63
5
0
0.037
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
Exon 1: 5UTRPDE
89079583 GRCh37
89298607 NCBI36
429-18436
AAGCGCTGCCTCCGAGCGCACGCAT C → G CTGAGATCCTGAGCCTTTGGTTAAG
- 
 
n=
C/C=
C/G=
G/G=
G=
136
68
0
0
0.000
136
66
2
0
0.015
136
68
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
Exon 1: 5UTRPDE
89079547 GRCh37
89298571 NCBI36
465-18400
GAGCCTTTGGTTAAGACCGAGCTCT A → G TTAAGCTGAGTGAGTAAATTGTAAA
- 
 
n=
A/A=
A/G=
G/G=
G=
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
136
62
6
0
0.044
n/a
0.000
PMT-272
Exon 2: CodingPDE37 pubsI
89061114 GRCh37
89280138 NCBI36
52734
CAGTAATGTCGAAGTTTTTATCCCA G → A TGTCACAAGGAAACACCAATGGCTT
-12
Val → Met
(D=21)
n=
G/G=
G/A=
A/A=
A=
156
66
12
0
0.077
152
66
10
0
0.066
114
28
27
2
0.272
94
35
10
2
0.149
2
1
0
0
0.000
Set-II
 PDE1 pubIA
89060909 GRCh37
89279933 NCBI36
  
GAACTTGTAAAAAGACAGCTTTTTA A → G TTTACCTACAGTGAACCTCACAGGT
- 
 
n=
A/A=
A/G=
G/G=
G=
156
70
8
0
0.051
152
66
10
0
0.066
114
28
27
2
0.272
94
35
9
3
0.160
2
1
0
0
0.000
Set-II
 PDE
89053790 GRCh37
89272814 NCBI36
  
GTAAATCAGTCTGTTTTTGTGTTTA C → T AGTGGGATCATGAAACCTGGTCTCA
- 
 
n=
C/C=
C/T=
T/T=
T=
160
76
4
0
0.025
160
80
0
0
0.000
118
59
0
0
0.000
100
50
0
0
0.000
8
4
0
0
0.000
Set-II
 PDE1 pubI
89053718 GRCh37
89272742 NCBI36
  
GTGGAGGCAAATCTTCGTGAGTATA A → G GAGAGTATAAGTAAGCGTTTTCTGT
- 
 
n=
A/A=
A/G=
G/G=
G=
160
71
9
0
0.056
160
72
8
0
0.050
118
49
10
0
0.085
100
37
12
1
0.140
8
4
0
0
0.000
Set-II
Exon 4: CodingPDE1 pubIA
89052964 GRCh37
89271988 NCBI36
862369
CCAATTTCAAATGTAATTCAGGTTA C → T GTGGTACAAGTAAGTATTAGTGGGT
-123
Tyr = Tyr
n=
C/C=
C/T=
T/T=
T=
158
66
13
0
0.082
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 5: CodingPDE159 pubsI
89052323 GRCh37
89271347 NCBI36
914421
CACTCTGACGGTGAGAGAAAACTTA C → A AGTTCTCAGCAGCTCTTCGGCTTGC
-141
Gln → Lys
(D=53)
n=
C/C=
C/A=
A/A=
A=
160
78
2
0
0.013
160
67
13
0
0.081
120
21
29
10
0.408
100
28
18
4
0.260
12
5
0
1
0.167
Set-II
 PDE1 pub
89042960 GRCh37
89261984 NCBI36
  
ACTGGTTGTTATCATTGACAATTAT A → G ATATTTGTGATTTAGGTTGGAACTC
- 
 
n=
A/A=
A/G=
G/G=
G=
160
37
37
6
0.306
160
76
4
0
0.025
120
58
2
0
0.017
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
Exon 6: CodingPDE4 pubsI
89042860 GRCh37
89261884 NCBI36
1109616
AATGGAGCTTATCACTGATCCTTCC A → C TCTTGTTCTTGGATGAGCCTACAAC
-206
Ile → Leu
(D=5)
n=
A/A=
A/C=
C/C=
C=
160
80
0
0
0.000
160
79
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 7: CodingPDE2 pubs
89039297 GRCh37
89258321 NCBI36
1298805
CTCAGGAAGACTTATGTTCCACGGG C → T CTGCTCAGGAGGCCTTGGGATACTT
-269
Pro → Ser
(D=74)
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE1 pubI
89039243 GRCh37
89258267 NCBI36
  
ATCAGCTGGTATGGTTGACTTTTTT A → G TGCTGTAAAATGCTTCATTAATAGA
- 
 
n=
A/A=
A/G=
G/G=
G=
160
51
28
1
0.188
160
79
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
89036238 GRCh37
89255262 NCBI36
  
CTTTGTTTTCCAAGACCATCAAGTT T → C GTGTTTTTGAGCTGCCTTCTTTCAT
- 
 
n=
T/T=
T/C=
C/C=
C=
160
80
0
0
0.000
160
80
0
0
0.000
118
59
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
Exon 9: CodingPDE
89034650 GRCh37
89253674 NCBI36
1492999
ATAAGCCACTCATAGAAAAATTAGC G → A GAGATTTATGTCAACTCCTCCTTCT
-333
Ala = Ala
n=
G/G=
G/A=
A/A=
A=
160
80
0
0
0.000
160
80
0
0
0.000
120
60
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
Exon 9: CodingPDE1 pub
89034551 GRCh37
89253575 NCBI36
15911098
AGAAGAAGATCACAGTCTTCAAGGA G → A ATCAGCTACACCACCTCCTTCTGTC
-366
Glu = Glu
n=
G/G=
G/A=
A/A=
A=
160
80
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
42
7
1
0.090
12
6
0
0
0.000
Set-II
 PDE2 pubsI
89028478 GRCh37
89247502 NCBI36
  
TATATTATACTAATAAATGGTGTGT A → T TAAGTTTTTATCTCTAATTGAAACT
- 
 
n=
A/A=
A/T=
T/T=
T=
158
66
12
1
0.089
158
34
33
12
0.361
118
33
21
5
0.263
100
35
12
3
0.180
12
5
1
0
0.083
Set-II
 PDE
89028439 GRCh37
89247463 NCBI36
  
CTAATTGAAACTCTTCCCCTTTTTT T → - GCATTTTTCTTTTTGAAAAGATCAT
- 
 
n=
T/T=
T/-=
-/-=
-=
158
79
0
0
0.000
158
79
0
0
0.000
118
59
0
0
0.000
100
50
0
0
0.000
12
5
1
0
0.083
Set-II
 PDE
89028284 GRCh37
89247308 NCBI36
  
AGAAAATGCTGTTACTTTCTTCAAG C → T TTATTGAAATCCATTAAGAATTTGA
- 
 
n=
C/C=
C/T=
T/T=
T=
158
79
0
0
0.000
158
79
0
0
0.000
118
56
3
0
0.025
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE1 pubI
89028269 GRCh37
89247293 NCBI36
  
TTTCTTCAAGCTTATTGAAATCCAT T → G AAGAATTTGAATTTAAGACAAGTAT
- 
 
n=
T/T=
T/G=
G/G=
G=
158
78
1
0
0.006
158
79
0
0
0.000
118
59
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
 PDE
89028236 GRCh37
89247260 NCBI36
  
TGAATTTAAGACAAGTATAGTGTAA A → C TGTCATTCTTTTATTGAGGGTAGGA
- 
 
n=
A/A=
A/C=
C/C=
C=
158
78
1
0
0.006
158
76
3
0
0.019
118
59
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE1 pubI
89028224 GRCh37
89247248 NCBI36
  
AAGTATAGTGTAAATGTCATTCTTT T → C ATTGAGGGTAGGATGAGTCAGTTTA
- 
 
n=
T/T=
T/C=
C/C=
C=
158
75
4
0
0.025
158
79
0
0
0.000
118
59
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
89028156 GRCh37
89247180 NCBI36
  
TGCTCTGTTGCCCAGGCTGGAGTGC A → G GTGACGCGATCTCAGCTCACTGCAA
- 
 
n=
A/A=
A/G=
G/G=
G=
158
79
0
0
0.000
158
78
1
0
0.006
118
59
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
89022500 GRCh37
89241524 NCBI36
  
CTGTCTAAGAATGCTGAGTTGACTG C → T GGTGATTTGGTTCCCCTTTTCATGG
- 
 
n=
C/C=
C/T=
T/T=
T=
160
78
2
0
0.013
160
80
0
0
0.000
118
59
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
89022367 GRCh37
89241391 NCBI36
  
AAGCTCTTCATGTGAGTAGGTCTTT G → T TTCTAGGAACGGGGCTGTCCAGCAG
- 
 
n=
G/G=
G/T=
T/T=
T=
160
75
5
0
0.031
160
80
0
0
0.000
118
59
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
 PDE1 pubI
89022362 GRCh37
89241386 NCBI36
  
CTTCATGTGAGTAGGTCTTTGTTCT A → G GGAACGGGGCTGTCCAGCAGCAGGG
- 
 
n=
A/A=
A/G=
G/G=
G=
160
10
25
45
0.719
160
70
9
1
0.069
118
34
23
2
0.229
100
36
11
3
0.170
12
3
2
1
0.333
Set-II
 PDE2 pubs
89020438 GRCh37
89239462 NCBI36
  
CAAAACAAAAAAGGACATGTCTTTA G → A TCTTGCCTATGGGTGAAGTCAGTTG
- 
 
n=
G/G=
G/A=
A/A=
A=
156
57
18
3
0.154
160
77
3
0
0.019
116
58
0
0
0.000
100
48
2
0
0.020
12
6
0
0
0.000
Set-II
Exon 13: CodingPDE
89018638 GRCh37
89237662 NCBI36
21071614
GTCAGAGTGTGGTTTCTGTAGCAAC A → G CTTCTCATGACCATCTGTTTTGTGT
-538
Thr = Thr
n=
A/A=
A/G=
G/G=
G=
160
80
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
10
5
0
0
0.000
Set-II
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 13: CodingPDE1 pub
89018628 GRCh37
89237652 NCBI36
21171624
GGTTTCTGTAGCAACACTTCTCATG A → G CCATCTGTTTTGTGTTTATGATGGT
-542
Thr → Ala
(D=58)
n=
A/A=
A/G=
G/G=
G=
160
77
3
0
0.019
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
10
5
0
0
0.000
Set-II
 PDE1 pubI
89018565 GRCh37
89237589 NCBI36
  
TGTTTGCTCTGATAAGGAATTGTTT T → C TTTCCTTCATTTCTTCCTGCACATT
- 
 
n=
T/T=
T/C=
C/C=
C=
160
61
16
3
0.138
160
31
34
15
0.400
120
34
24
2
0.233
100
23
20
7
0.340
10
2
2
1
0.400
Set-II
 PDE1 pub
89018540 GRCh37
89237564 NCBI36
  
TTTTCCTTCATTTCTTCCTGCACAT T → G CACTTGTCATGTAAAACCTGTTTTG
- 
 
n=
T/T=
T/G=
G/G=
G=
158
79
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
10
5
0
0
0.000
Set-II
 PDEI
89016782 GRCh37
89235806 NCBI36
  
TGAAATTACTCAAGCAGGCCTGACT T → C TTAGTATTTGCTTTTTGTAGATTTT
- 
 
n=
T/T=
T/C=
C/C=
C=
160
17
35
28
0.569
160
0
8
72
0.950
120
2
24
34
0.767
100
2
12
36
0.840
12
1
2
3
0.667
Set-II
 PDE
89016623 GRCh37
89235647 NCBI36
  
GTGACTGCATTCCCAAGCTAGGAAC A → G ATGGAAATCAAGTGTCCTCATCTCA
- 
 
n=
A/A=
A/G=
G/G=
G=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE1 pubI
89015857 GRCh37
89234881 NCBI36
  
TGTGATAACTCTTTGGAAACTTCTT G → A AAATTTAAAACTGTTTACCTTGCCC
- 
 
n=
G/G=
G/A=
A/A=
A=
160
44
27
9
0.281
160
2
22
56
0.838
120
16
32
12
0.467
100
11
16
23
0.620
10
1
2
2
0.600
Set-II
 PDE
89013596 GRCh37
89232620 NCBI36
  
TAGGCTCCTTTAAGGAACAGTGGAT A → G TACTGAGTAACATTTGACGGATGCT
- 
 
n=
A/A=
A/G=
G/G=
G=
158
79
0
0
0.000
158
79
0
0
0.000
118
58
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 16: CodingPDE5 pubs
89013496 GRCh37
89232520 NCBI36
23511858
AGAATATTTGGTAAAGCAGGGCATC G → A ATCTCTCACCCTGGGGCTTGTGGAA
-620
Asp → Asn
(D=23)
n=
G/G=
G/A=
A/A=
A=
158
78
1
0
0.006
158
78
1
0
0.006
118
59
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 16: 3UTRPDE
89013169 GRCh37
89232193 NCBI36
2678 
ATTTCTTCCCCATGGTTACTGTCTG A → G GGAGATTAACTAATATGCGATACAT
+ 
 
n=
A/A=
A/G=
G/G=
G=
136
67
1
0
0.007
134
67
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
n/a
0.000
PMT-272
Exon 16: 3UTRPDE
89013022 GRCh37
89232046 NCBI36
2825 
CCATAGCATCATAAAGTATTAAGAC T → TA GAAGGGCTACTAACCTACCTATTCA
+ 
 
n=
T/T=
T/TA=
TA/TA=
TA=
136
67
1
0
0.007
134
67
0
0
0.000
136
56
12
0
0.088
134
67
0
0
0.000
n/a
0.000
PMT-272
Exon 16: 3UTRPDE
89012889 GRCh37
89231913 NCBI36
2958 
TATCAAAAAGATTTTTTTTCTATCA C → T GGTGGCTTTTTTTACCCTATAAGAC
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
68
0
0
0.000
134
67
0
0
0.000
136
68
0
0
0.000
134
66
1
0
0.007
n/a
0.000
PMT-272
Exon 16: 3UTRPDE
89012466 GRCh37
89231490 NCBI36
3381 
AAGGTTAGAATGAAGAGAACATAAG G → A TATATAAGTAGGAAAGAAAACCTAT
+ 
 
n=
G/G=
G/A=
A/A=
A=
134
67
0
0
0.000
132
66
0
0
0.000
136
67
1
0
0.007
132
66
0
0
0.000
n/a
0.000
PMT-272
Exon 16: 3UTRPDE
89012332 GRCh37
89231356 NCBI36
3515 
GCTACAATCTTCTATTTCTTGACCT G → A AATTGATGGTTGCACATGTGTGTTC
+ 
 
n=
G/G=
G/A=
A/A=
A=
134
67
0
0
0.000
132
66
0
0
0.000
136
67
1
0
0.007
132
66
0
0
0.000
n/a
0.000
PMT-272
Exon 16: 3UTRPDEI
89012320 GRCh37
89231344 NCBI36
3527 
AGGCTTTTGTGTGCTACAATCTTCT A → G TTTCTTGACCTGAATTGATGGTTGC
+ 
 
n=
A/A=
A/G=
G/G=
G=
134
63
4
0
0.030
132
64
2
0
0.015
136
31
30
7
0.324
132
63
3
0
0.023
n/a
0.000
PMT-272
Exon 16: 3UTRI
89012091 GRCh37
89231115 NCBI36
3756 
GAACTTTCCTCACTATCTTTGCAAC T → A TTTCTGTCAATCTAAAATTATTTCC
+ 
 
n=
T/T=
T/A=
A/A=
A=
136
66
2
0
0.015
136
68
0
0
0.000
134
67
0
0
0.000
134
67
0
0
0.000
n/a
0.000
PMT-272
Exon 16: 3UTR
89011718 GRCh37
89230742 NCBI36
4129 
GTTCAAAGATAAAAATATAATGCCA T → C GTTCCCAAATTGATGTTGTGACAGA
+ 
 
n=
T/T=
T/C=
C/C=
C=
136
67
1
0
0.007
136
68
0
0
0.000
134
67
0
0
0.000
134
67
0
0
0.000
n/a
0.000
PMT-272
Exon 16: 3UTR
89011660 GRCh37
89230684 NCBI36
4187 
AAAAAGATAATGTGTTCCAAGATGA C → T GCATTAATCAAATGTCATCCAAAAA
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
61
7
0
0.051
136
68
0
0
0.000
134
67
0
0
0.000
134
67
0
0
0.000
n/a
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.