UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:WHITE2
HGNC Symbol:ABCG4
HGNC Description:ATP-binding cassette, sub-family G (WHITE), member 4
HGNC ID:13884
Superfamily:ABC
Chromosome:Chr.11(+): 119019750-119033375 GRCh37
Location:11q23.3
OMIM:607784
OMIM Phenotype:None
Accessions:BC041091
Nucleotide RefSeq:NM_022169
Protein RefSeq:NP_071452
Entrez:64137
Ensembl:ENSG00000172350
Isoforms:2
Evidence:None
Tissues:None
Type:protein-coding
Sets:0
PharmGKB ID:PA24410
HPRD ID:12130
Substrates:None
Trivial Names:WHITE2
Transcripts:NM_022169.4 [Chr.11(+): 119019750-119033375 GRCh37]
NM_001142505.1 [Chr.11(+): 119020299-119033375 GRCh37]
ENST00000307417 [Chr.11(+): 119019722-119033360 GRCh37]
ENST00000449422 [Chr.11(+): 119020223-119032145 GRCh37]
ENST00000524604 [Chr.11(+): 119019963-119025069 GRCh37]
ENST00000531739 [Chr.11(+): 119020606-119032357 GRCh37]
ENST00000533694 [Chr.11(+): 119023585-119031081 GRCh37]
ENST00000534402 [Chr.11(+): 119026340-119029205 GRCh37]

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for ABCG4.

Variant Data

View all PMT variants for ABCG4 on UCSC Genome Browser
Showing SNP features for transcript:   
ABCG4 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:ABCG4 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
119019475 GRCh37
118524685 NCBI36
-275-1201
GGACTGGTATCGTGTGTGAAGACAG A → T CTGACACCTTTACAATCCCTCCACT
+ 
 
n=
A/A=
A/T=
T/T=
T=
130
59
6
0
0.046
134
63
4
0
0.030
116
44
12
2
0.138
128
60
4
0
0.031
PMT-272
PromoterPDEI
119019520 GRCh37
118524730 NCBI36
-230-1156
TCCACTTTCCCCCACCCCCAACACC C → A TTGCCTAATCTGTCTTCCAGGGACT
+ 
 
n=
C/C=
C/A=
A/A=
A=
130
51
5
9
0.177
134
52
1
14
0.216
118
8
0
51
0.864
128
59
0
5
0.078
PMT-272
PromoterPDE
119019633 GRCh37
118524843 NCBI36
-117-1043
CAACCCCCAGTCCTGAGTTCACCCC T → G GCACCTCCTCCGGCCCCCGCGCCGC
+ 
 
n=
T/T=
T/G=
G/G=
G=
130
65
0
0
0.000
134
67
0
0
0.000
118
59
0
0
0.000
128
63
1
0
0.008
PMT-272
PromoterPDE
119019647 GRCh37
118524857 NCBI36
-103-1029
GAGTTCACCCCTGCACCTCCTCCGG C → T CCCCGCGCCGCAAGCGCTGCTCTCT
+ 
 
n=
C/C=
C/T=
T/T=
T=
132
65
1
0
0.008
134
67
0
0
0.000
118
59
0
0
0.000
128
64
0
0
0.000
PMT-272
PromoterPDE
119019688 GRCh37
118524898 NCBI36
-62-988
GCTGCTCTCTCCTTTGCCGTCCTCG C → CC CCCCCGCGGGCTGCCGGGCGGCGCG
+ 
 
n=
C/C=
C/CC=
CC/CC=
CC=
132
64
2
0
0.015
134
67
0
0
0.000
118
59
0
0
0.000
128
64
0
0
0.000
PMT-272
Promoter
Exon 1: 5UTR
PDE
119019782 GRCh37
118524992 NCBI36
33-894
AGAGCGCAGTCGCCCCGCGGGCTCG G → A AGGACACAGCGTCCGGGACCAGGCT
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
65
0
0
0.000
126
63
0
0
0.000
112
50
6
0
0.054
128
64
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.