UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:ABCG5
HGNC Symbol:ABCG5
HGNC Description:ATP-binding cassette, sub-family G (WHITE), member 5
HGNC ID:13886
Superfamily:ABC
Chromosome:Chr.2(-): 44039611-44066039 GRCh37
Location:2p21
OMIM:605459
OMIM Phenotype:Sitosterolemia
Accessions:NM_022436
Nucleotide RefSeq:NM_022436
Protein RefSeq:NP_071881
Entrez:64240
Ensembl:ENSG00000138075
Isoforms:4
Evidence:Substrate In Vivo Evidence: Cholesterol 1. ABCG5/G8 adenovirus expression in ABCG5/G8 null mice. Graf GA, et al. JBC. 2003; 278: 48275-82. 2. ABCG5/G8 K.O. mouse. Yu L, et al. JBC. 2003; 278:15565-70. Tissue Distribution Evidence: Small Intestine 1. RT-PCR. Berge KE, et al. Science. 2000; 290:1771-5. 2. TaqMan RT-PCR. Langmann T, et al. Clinical Chemistry. 2003; 49: 230-8. Liver 1. RT-PCR. Berge KE, et al. Science. 2000; 290:1771-5. 2. TaqMan RT-PCR. Langmann T, et al. Clinical Chemistry. 2003; 49: 230-8. Gallbladder - RT-PCR. Tauscher A, et al. Biochem Biophys Res Commun. 2003; 307:1021-8
Tissues:Small intestine, Liver, Gallbladder
Type:protein-coding
Sets:V
PharmGKB ID:PA24411
HPRD ID:05678
Substrates:Cholesterol
Trivial Names:STSL
Transcripts:NM_022436.2 [Chr.2(-): 44039611-44065958 GRCh37]
XM_005264482.1 [Chr.2(-): 44039972-44051780 GRCh37]
XM_005264480.1 [Chr.2(-): 44040327-44066039 GRCh37]
XM_005264481.1 [Chr.2(-): 44049640-44066039 GRCh37]
ENST00000260645 [Chr.2(-): 44039611-44065958 GRCh37]
ENST00000405322 [Chr.2(-): 44039699-44065891 GRCh37]
ENST00000409962 [Chr.2(-): 44039982-44066004 GRCh37]
ENST00000486512 [Chr.2(-): 44039699-44065889 GRCh37]
ENST00000543989 [Chr.2(-): 44039699-44065889 GRCh37]
Annotation History:View Events (26)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for ABCG5.

Variant Data

View all PMT variants for ABCG5 on UCSC Genome Browser
Showing SNP features for transcript:   
ABCG5 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:ABCG5 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
44066352 GRCh37
43919856 NCBI36
-394-534
TCAGGAGCCTTCTGTCCTAGCACCA C → A CCGGACATCAAGCAGTGTGAGGACA
+ 
 
n=
C/C=
C/A=
A/A=
A=
132
64
2
0
0.015
130
65
0
0
0.000
134
67
0
0
0.000
128
64
0
0
0.000
PMT-272
 PDE8 pubs
44066247 GRCh37
43919751 NCBI36
-289-429
GCTGCCGAAAGGGGCCACTCCCCAG G → C ATACCTCGGTGAGTGAGCAATGGGA
+ 
 
n=
G/G=
G/C=
C/C=
C=
132
59
6
1
0.061
132
57
9
0
0.068
136
65
3
0
0.022
130
46
18
1
0.154
PMT-272
 PDE
44066243 GRCh37
43919747 NCBI36
-285-425
GAGGGCTGCCGAAAGGGGCCACTCC C → A CAGGATACCTCGGTGAGTGAGCAAT
+ 
 
n=
C/C=
C/A=
A/A=
A=
132
63
3
0
0.023
132
66
0
0
0.000
136
68
0
0
0.000
130
65
0
0
0.000
PMT-272
PromoterPDE
44066178 GRCh37
43919682 NCBI36
-220-360
TAAGAGAGCTGCAGCCCAGGGTCAC A → C GACCTGTGGGCCCCATGGCCGGGAA
+ 
 
n=
A/A=
A/C=
C/C=
C=
132
52
13
1
0.114
132
66
0
0
0.000
136
68
0
0
0.000
130
65
0
0
0.000
PMT-272
PromoterPDE2 pubs
44066174 GRCh37
43919678 NCBI36
-216-356
GGTCTAAGAGAGCTGCAGCCCAGGG T → G CACAGACCTGTGGGCCCCATGGCCG
+ 
 
n=
T/T=
T/G=
G/G=
G=
132
23
36
7
0.379
132
29
31
6
0.326
136
1
20
47
0.838
130
29
31
5
0.315
PMT-272
PromoterPDE
44066007 GRCh37
43919511 NCBI36
-49-189
GTACCTTTAGCCAGCGCGTCCTTAT C → G TTGACAGTGGGCAGAACACACACGT
+ 
 
n=
C/C=
C/G=
G/G=
G=
132
65
1
0
0.008
132
66
0
0
0.000
136
68
0
0
0.000
128
64
0
0
0.000
PMT-272
Exon 1: 5UTR
Promoter
PDE
44065936 GRCh37
43919440 NCBI36
23-118
CTGCTCCACCTGACCCCGGAGTCCC T → G TGGGACAGCAGGACTGGGACTTGGC
+ 
 
n=
T/T=
T/G=
G/G=
G=
132
65
1
0
0.008
130
65
0
0
0.000
136
68
0
0
0.000
128
62
2
0
0.016
PMT-272
 PDE
44040562 GRCh37
43894066 NCBI36
  
TTAATGAAAAATACAGGACACTTTA G → C CAAGCCCAGAGTTTACAATTTGATG
+ 
 
n=
G/G=
G/C=
C/C=
C=
134
58
9
0
0.067
136
68
0
0
0.000
136
63
5
0
0.037
136
67
1
0
0.007
PMT-272
 PDE
44040455 GRCh37
43893959 NCBI36
  
ACAGAAACATTTGAGCTGCCTGTCA A → C GGAAAAGATTGACAGTGTCAGGTGT
+ 
 
n=
A/A=
A/C=
C/C=
C=
134
64
3
0
0.022
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 13: CodingPDE16 pubsI
44040401 GRCh37
43893905 NCBI36
19501810
GTTTTCTCAATGAATTGAATTCCTT G → C AGTGAAGGCACACATTGGATTAGTT
+604
Gln → Glu
(D=29)
n=
G/G=
G/C=
C/C=
C=
136
35
25
8
0.301
136
43
21
4
0.213
136
50
16
2
0.147
136
36
24
8
0.294
PMT-272
Exon 13: 3UTRPDE
44040183 GRCh37
43893687 NCBI36
2168 
TGTCAAGAAAGAAATACATGGCACT C → T TCATTTCAGACGTTCAGAGCAGTCA
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
64
4
0
0.029
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 13: 3UTRPDE
44040167 GRCh37
43893671 NCBI36
2184 
AAGACTTGAGATGTCCTGTCAAGAA A → G GAAATACATGGCACTCTCATTTCAG
+ 
 
n=
A/A=
A/G=
G/G=
G=
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 13: 3UTRPDE
44040037 GRCh37
43893541 NCBI36
2314 
TCCGCTCAGTCACAATTTCCAAATA A → - CCACATGTCCCTGCAAGTTGTAAGA
+ 
 
n=
A/A=
A/-=
-/-=
-=
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 13: 3UTRPDE
44039961 GRCh37
43893465 NCBI36
2390 
TCTGTGCCTAGAACAAGGAAAAAAA A → AA TAGTCACACGAGTCTCCCATAGGTT
+ 
 
n=
A/A=
A/AA=
AA/AA=
AA=
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 13: 3UTRPDEIA
44039875 GRCh37
43893379 NCBI36
2476 
ACTTATGGTCAGGAATCCTTGAAAC A → C TTTTATTTTTGCCTAATCCTTTATC
+ 
 
n=
A/A=
A/C=
C/C=
C=
134
10
23
34
0.679
136
26
34
8
0.368
136
44
21
3
0.199
136
21
29
18
0.478
PMT-272
Exon 13: 3UTRPDE
44039856 GRCh37
43893360 NCBI36
2495 
ACAACTCTCTTTCTCTGTCACTTAT G → A GTCAGGAATCCTTGAAACATTTTAT
+ 
 
n=
G/G=
G/A=
A/A=
A=
134
57
10
0
0.075
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 13: 3UTRPDEIA
44039839 GRCh37
43893343 NCBI36
2512 
TTGCTTCATCTAAACCCACAACTCT C → T TTTCTCTGTCACTTATGGTCAGGAA
+ 
 
n=
C/C=
C/T=
T/T=
T=
134
32
26
9
0.328
136
43
22
3
0.206
136
50
16
2
0.147
136
36
24
8
0.294
PMT-272
Exon 13: 3UTRPDE
44039737 GRCh37
43893241 NCBI36
2614 
CTCGATGTGATCAGGTAACTCCGAC C → T CCTCGTGTGGACATCTGCATTTAAC
+ 
 
n=
C/C=
C/T=
T/T=
T=
134
67
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 13: 3UTRPDE
44039733 GRCh37
43893237 NCBI36
2618 
CTCTCTCGATGTGATCAGGTAACTC C → T GACCCCTCGTGTGGACATCTGCATT
+ 
 
n=
C/C=
C/T=
T/T=
T=
134
38
25
4
0.246
136
49
16
3
0.162
136
67
1
0
0.007
136
49
16
3
0.162
PMT-272
Exon 13: 3UTRPDE
44039720 GRCh37
43893224 NCBI36
2631 
CATCTGCCCAGCACTCTCTCGATGT G → A ATCAGGTAACTCCGACCCCTCGTGT
+ 
 
n=
G/G=
G/A=
A/A=
A=
134
67
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
136
66
2
0
0.015
PMT-272
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
Exon 13: 3UTRPDE
44039634 GRCh37
43893138 NCBI36
2717 
GTTCACTGTTGAGCCCATTCCTACG G → A TTTTTTATTTTAATCCTCAGTAAAA
+ 
 
n=
G/G=
G/A=
A/A=
A=
134
67
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 13: 3UTRPDEI
44039633 GRCh37
43893137 NCBI36
2718 
TGTTCACTGTTGAGCCCATTCCTAC G → A GTTTTTTATTTTAATCCTCAGTAAA
+ 
 
n=
G/G=
G/A=
A/A=
A=
134
27
27
13
0.396
136
43
22
3
0.206
136
45
21
2
0.184
136
35
25
8
0.301
PMT-272
 PDE
44039514 GRCh37
43893018 NCBI36
  
TTTTATACTTTAAGTTTTAGGGTAC A → G TGTGCACAATGTGCCTATAAGTAAA
+ 
 
n=
A/A=
A/G=
G/G=
G=
134
63
4
0
0.030
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
 PDE
44039492 GRCh37
43892996 NCBI36
  
TTTTTTCGGTAGGTTTTTTTTTTTT T → A ATACTTTAAGTTTTAGGGTACATGT
+ 
 
n=
T/T=
T/A=
A/A=
A=
134
67
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.