UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:ABCG8
HGNC Symbol:ABCG8
HGNC Description:ATP-binding cassette, sub-family G (WHITE), member 8
HGNC ID:13887
Superfamily:ABC
Chromosome:Chr.2(+): 44066103-44105947 GRCh37
Location:2p21
OMIM:605460
OMIM Phenotype:Sitosterolemia
Accessions:NM_022437
Nucleotide RefSeq:NM_022437
Protein RefSeq:NP_071882
Entrez:64241
Ensembl:ENSG00000143921
Isoforms:2
Evidence:Substrate In Vivo Evidence: Cholesterol 1. ABCG5/G8 adenovirus expression in ABCG5/G8 null mice. Graf GA, et al. JBC. 2003; 278: 48275-82. 2. ABCG5/G8 K.O. mouse. Yu L, et al. JBC. 2003; 278:15565-70. Tissue Distribution Evidence: Small Intestine 1. RT-PCR. Berge KE, et al. Science. 2000; 290:1771-5. 2. TaqMan RT-PCR. Langmann T, et al. Clinical Chemistry. 2003; 49: 230-8. Liver 1. RT-PCR. Berge KE, et al. Science. 2000; 290:1771-5. 2. TaqMan RT-PCR. Langmann T, et al. Clinical Chemistry. 2003; 49: 230-8. Gallbladder 1. RT-PCR. Tauscher A, et al. Biochem Biophys Res Commun. 2003; 307:1021-8.
Tissues:Small intestine, Liver, Gallbladder
Type:protein-coding
Sets:V
PharmGKB ID:PA24412
HPRD ID:05679
Substrates:Cholesterol
Trivial Names:GBD4, STSL
Transcripts:NM_022437.2 [Chr.2(+): 44066103-44105605 GRCh37]
XM_005264483.1 [Chr.2(+): 44066120-44105947 GRCh37]
ENST00000272286 [Chr.2(+): 44066103-44105605 GRCh37]
Annotation History:View Events (10)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for ABCG8.

Variant Data

View all PMT variants for ABCG8 on UCSC Genome Browser
Showing SNP features for transcript:   
ABCG8 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:ABCG8 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
44065646 GRCh37
43919150 NCBI36
-457-547
GAGCGCCGGGCCCCGCACTCCTGGG G → A GAGCAGCAGCAGCAAGGGCTCTGCC
+ 
 
n=
G/G=
G/A=
A/A=
A=
126
62
1
0
0.008
134
67
0
0
0.000
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
 PDE
44065680 GRCh37
43919184 NCBI36
-423-513
GCAGCAAGGGCTCTGCCTTACCTGA C → A GCTGTAGGAGGCATGGAGGATGCCC
+ 
 
n=
C/C=
C/A=
A/A=
A=
128
60
4
0
0.031
134
67
0
0
0.000
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
 PDE
44065769 GRCh37
43919273 NCBI36
-334-424
CAGGGAGCTCTGGGAGCCTCTGTTT A → C CTTGGAGACCCATGGACCCTCCGGG
+ 
 
n=
A/A=
A/C=
C/C=
C=
128
63
1
0
0.008
134
67
0
0
0.000
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
 PDE
44065792 GRCh37
43919296 NCBI36
-311-401
TTACTTGGAGACCCATGGACCCTCC G → A GGGGTCAAAGATGAGAGGTCACCCA
+ 
 
n=
G/G=
G/A=
A/A=
A=
128
64
0
0
0.000
134
67
0
0
0.000
136
66
2
0
0.015
132
66
0
0
0.000
PMT-272
PromoterPDE
44065936 GRCh37
43919440 NCBI36
-167-257
CTGCTCCACCTGACCCCGGAGTCCC T → G TGGGACAGCAGGACTGGGACTTGGC
+ 
 
n=
T/T=
T/G=
G/G=
G=
126
62
1
0
0.008
134
67
0
0
0.000
136
68
0
0
0.000
132
64
2
0
0.015
PMT-272
PromoterPDE
44066007 GRCh37
43919511 NCBI36
-96-186
GTACCTTTAGCCAGCGCGTCCTTAT C → G TTGACAGTGGGCAGAACACACACGT
+ 
 
n=
C/C=
C/G=
G/G=
G=
126
62
1
0
0.008
134
67
0
0
0.000
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 13: CodingPDE2 pubsIA
44104925 GRCh37
43958429 NCBI36
19851895
TGTCTGTGTCTCCAGATCCTCAGTG T → C CATGGAGCTGGACTCGTACCCTCTC
+632
Val → Ala
(D=64)
n=
T/T=
T/C=
C/C=
C=
136
0
5
63
0.963
136
0
21
47
0.846
136
0
0
68
1.000
136
0
16
52
0.882
PMT-272
Exon 13: CodingPDE
44104971 GRCh37
43958475 NCBI36
20311941
CTCTCTACGCCATCTACCTCATCGT C → G ATTGGCCTCAGCGGTGGCTTCATGG
+647
Val = Val
n=
C/C=
C/G=
G/G=
G=
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
PMT-272
Exon 13: 3UTRPDE
44105135 GRCh37
43958639 NCBI36
2195 
CCCTCCTCAGGAGCCCCTTCCTGGG G → A ACAGTGAGGACAATGACCCTACAGA
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
68
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 13: 3UTRPDE
44105148 GRCh37
43958652 NCBI36
2208 
CCCCTTCCTGGGGACAGTGAGGACA A → - TGACCCTACAGATGCTCAGCTACAT
+ 
 
n=
A/A=
A/-=
-/-=
-=
136
68
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.