UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:None
HGNC Symbol:AQP4
HGNC Description:aquaporin 4
HGNC ID:637
Superfamily:None
Chromosome:Chr.18(-): 24432007-24445735 GRCh37
Location:18q11.2-q12.1
OMIM:600308
OMIM Phenotype:None
Accessions:None
Nucleotide RefSeq:NM_001650
Protein RefSeq:NP_001641
Entrez:361
Ensembl:ENSG00000171885
Isoforms:3
Evidence:None
Tissues:None
Type:protein-coding
Sets:None
PharmGKB ID:PA24922
HPRD ID:02631
Substrates:None
Trivial Names:MIWC, HMIWC2
Transcripts:NM_001650.4 [Chr.18(-): 24432007-24445716 GRCh37]
NM_004028.3 [Chr.18(-): 24432007-24442575 GRCh37]
XM_005258257.1 [Chr.18(-): 24432007-24445735 GRCh37]
ENST00000383168 [Chr.18(-): 24432002-24445782 GRCh37]
ENST00000383170 [Chr.18(-): 24441218-24445735 GRCh37]
ENST00000440832 [Chr.18(-): 24436175-24443154 GRCh37]
ENST00000578776 [Chr.18(-): 24440749-24445671 GRCh37]
ENST00000581374 [Chr.18(-): 24435781-24442812 GRCh37]
ENST00000583022 [Chr.18(-): 24436253-24442140 GRCh37]
ENST00000584088 [Chr.18(-): 24440655-24442370 GRCh37]
Annotation History:View Events (10)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for AQP4.

Variant Data

View all PMT variants for AQP4 on UCSC Genome Browser
Showing SNP features for transcript:   
AQP4 Resequencing  
AQP4 and Traumatic Brain Injury  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:AQP4 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
PromoterPDEA
24445847 GRCh37
22699845 NCBI36
-131-194
TAAATGTTTTTGCATTCCTGAAATG C → T CCTGTGTCTACAGTGATCAGGTACA
- 
 
n=
C/C=
C/T=
T/T=
T=
94
41
5
1
0.074
82
26
15
0
0.183
94
22
15
10
0.372
94
32
14
1
0.170
D76SampleSet
Exon 1: 5UTR
Promoter
PDE
24445695 GRCh37
22699693 NCBI36
22-42
ATCTGACTCCCAGCACACAGGGAGC T → C GCGGGGCAGGCAATGAGAGCTGCAC
- 
 
n=
T/T=
T/C=
C/C=
C=
94
45
2
0
0.021
82
41
0
0
0.000
94
47
0
0
0.000
94
47
0
0
0.000
D76SampleSet
Exon 1: 5UTR
Promoter
PDE
24445692 GRCh37
22699690 NCBI36
25-39
TGACTCCCAGCACACAGGGAGCTGC G → A GGGCAGGCAATGAGAGCTGCACTCT
- 
 
n=
G/G=
G/A=
A/A=
A=
94
41
5
1
0.074
82
26
15
0
0.183
94
22
15
10
0.372
94
33
13
1
0.160
D76SampleSet
 PDE
24442580 GRCh37
22696578 NCBI36
  
ACCTGGGTGTAGTGGCTTCTGATGC T → C GATTTGTTTCTCTTTTCAGTAAGTG
- 
 
n=
T/T=
T/C=
C/C=
C=
94
46
1
0
0.011
74
37
0
0
0.000
94
47
0
0
0.000
86
43
0
0
0.000
D76SampleSet
Exon 2: CodingPDE
24442392 GRCh37
22696390 NCBI36
264201
GGGGTGGAACAGAAAAGCCTTTACC G → T GTCGACATGGTTCTCATCTCCCTTT
-67
Pro = Pro
n=
G/G=
G/T=
T/T=
T=
94
45
2
0
0.021
74
27
9
1
0.149
94
47
0
0
0.000
86
40
3
0
0.035
D76SampleSet
Exon 2: CodingPDE1 pub
24442227 GRCh37
22696225 NCBI36
429366
AGTCTGTCTTCTACATCGCAGCCCA G → A TGCCTGGGGGCCATCATTGGAGCAG
-122
Gln = Gln
n=
G/G=
G/A=
A/A=
A=
94
45
2
0
0.021
74
33
4
0
0.054
94
47
0
0
0.000
86
42
1
0
0.012
D76SampleSet
Exon 2: CodingPDE1 pub
24442210 GRCh37
22696208 NCBI36
446383
GCAGCCCAGTGCCTGGGGGCCATCA T → C TGGAGCAGGAATCCTCTATCTGGTC
-128
Ile → Thr
(D=89)
n=
T/T=
T/C=
C/C=
C=
94
46
1
0
0.011
74
37
0
0
0.000
94
47
0
0
0.000
86
42
1
0
0.012
D76SampleSet
 PDE
24442130 GRCh37
22696128 NCBI36
  
AGTCACCATGGTAGCATCTTTAGCT A → G TTTTCAAACTAGGACTCCAAGCTTC
- 
 
n=
A/A=
A/G=
G/G=
G=
94
45
2
0
0.021
74
37
0
0
0.000
94
47
0
0
0.000
86
43
0
0
0.000
D76SampleSet
 PDE
24442107 GRCh37
22696105 NCBI36
  
CTATTTTCAAACTAGGACTCCAAGC T → C TCTTGCAAACTCTTTGCTAAATAAT
- 
 
n=
T/T=
T/C=
C/C=
C=
94
46
1
0
0.011
74
37
0
0
0.000
94
47
0
0
0.000
86
42
1
0
0.012
D76SampleSet
 PDE
24442056 GRCh37
22696054 NCBI36
  
GCCTTGGTGGCATGAGGCACATCCC T → C AAAATAGCTAATTTACTCCTAGGGA
- 
 
n=
T/T=
T/C=
C/C=
C=
94
43
4
0
0.043
74
23
14
0
0.189
94
21
16
10
0.383
86
31
11
1
0.151
D76SampleSet
Exon 3: CodingPDE1 pub
24441215 GRCh37
22695213 NCBI36
555492
CTGGTCATGGTCTCCTGGTTGAGTT G → A ATAATCACATTTCAATTGGTGTTTA
-164
Leu = Leu
n=
G/G=
G/A=
A/A=
A=
94
43
4
0
0.043
84
38
3
1
0.060
94
47
0
0
0.000
88
42
2
0
0.023
D76SampleSet
Exon 3: CodingPDE2 pubs
24441155 GRCh37
22695153 NCBI36
615552
CCAGCTGTGATTCCAAACGGACTGA T → A GTCACTGGCTCAATAGCTTTAGCAA
-184
Asp → Glu
(D=45)
n=
T/T=
T/A=
A/A=
A=
94
45
2
0
0.021
84
42
0
0
0.000
94
47
0
0
0.000
88
43
1
0
0.011
D76SampleSet
 PDE
24440884 GRCh37
22694882 NCBI36
  
TCTAAGTGACAAATGACAGCAAATT G → A CAATGAATGATACTTGCTAGTAGCC
- 
 
n=
G/G=
G/A=
A/A=
A=
94
40
7
0
0.074
88
44
0
0
0.000
92
46
0
0
0.000
94
47
0
0
0.000
D76SampleSet
Exon 4: CodingPDE1 pub
24440816 GRCh37
22694814 NCBI36
676613
GAAGTTGTTTTCTTGTTTCCTATAG A → C TCAATTATACTGGTGCCAGCATGAA
-205
Ile → Leu
(D=5)
n=
A/A=
A/C=
C/C=
C=
94
46
1
0
0.011
88
44
0
0
0.000
92
46
0
0
0.000
94
45
2
0
0.021
D76SampleSet
Exon 4: CodingPDE1 pub
24440758 GRCh37
22694756 NCBI36
734671
CGATCCTTTGGACCTGCAGTTATCA T → C GGGAAATTGGGAAAACCATTGGGTA
-224
Met → Thr
(D=81)
n=
T/T=
T/C=
C/C=
C=
94
47
0
0
0.000
88
43
1
0
0.011
92
46
0
0
0.000
94
46
1
0
0.011
D76SampleSet
Exon 4: CodingPDE
24440739 GRCh37
22694737 NCBI36
753690
TTATCATGGGAAATTGGGAAAACCA T → C TGGGTAACCCTCATATTGATAGTTC
-230
His = His
n=
T/T=
T/C=
C/C=
C=
94
47
0
0
0.000
88
43
1
0
0.011
92
46
0
0
0.000
94
47
0
0
0.000
D76SampleSet
 PDE
24436519 GRCh37
22690517 NCBI36
  
AATTTAACCCAGCTAGATTCTACAT T → C CATGAGCTGCTCAATGGAATAGCTT
- 
 
n=
T/T=
T/C=
C/C=
C=
94
37
10
0
0.106
76
24
11
3
0.224
92
18
17
11
0.424
84
18
16
8
0.381
D76SampleSet
 PDE
24436504 GRCh37
22690502 NCBI36
  
GATTCTACATTCATGAGCTGCTCAA T → A GGAATAGCTTTTCTCTACTTACACT
- 
 
n=
T/T=
T/A=
A/A=
A=
94
46
1
0
0.011
76
38
0
0
0.000
92
46
0
0
0.000
84
42
0
0
0.000
D76SampleSet
Exon 5: CodingPDE
24436328 GRCh37
22690326 NCBI36
882819
CCTTCAGCAAAGCTGCCCAGCAAAC A → G AAAGGAAGCTACATGGAGGTGGAGG
-273
Thr = Thr
n=
A/A=
A/G=
G/G=
G=
94
46
1
0
0.011
76
38
0
0
0.000
92
46
0
0
0.000
84
42
0
0
0.000
D76SampleSet
Exon 5: 3UTRPDE
24435955 GRCh37
22689953 NCBI36
1255 
ATCTAAAAAAAGAAATATTTTTAAA A → C TGTTCTTAAGCAAATATATACCTAT
- 
 
n=
A/A=
A/C=
C/C=
C=
92
46
0
0
0.000
82
40
0
1
0.024
94
47
0
0
0.000
94
47
0
0
0.000
D76SampleSet
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
Exon 5: 3UTRPDE
24435930 GRCh37
22689928 NCBI36
1280 
ATGTTCTTAAGCAAATATATACCTA T → C TTTATCTAGTTACCTTTCATTAACA
- 
 
n=
T/T=
T/C=
C/C=
C=
92
42
4
0
0.043
82
41
0
0
0.000
94
47
0
0
0.000
94
47
0
0
0.000
D76SampleSet
Exon 5: 3UTRPDE
24435892 GRCh37
22689890 NCBI36
1318 
CCTTTCATTAACAACCAATTTTAAC C → T GTGTGTCAAGATTTGGTTAAGTCTT
- 
 
n=
C/C=
C/T=
T/T=
T=
92
30
14
2
0.196
82
41
0
0
0.000
94
47
0
0
0.000
94
47
0
0
0.000
D76SampleSet
Exon 5: 3UTRPDE
24435871 GRCh37
22689869 NCBI36
1339 
TAACCGTGTGTCAAGATTTGGTTAA G → C TCTTGCCTGACAGAACTCAAAGACA
- 
 
n=
G/G=
G/C=
C/C=
C=
92
44
2
0
0.022
82
41
0
0
0.000
94
47
0
0
0.000
94
46
1
0
0.011
D76SampleSet
Exon 5: 3UTRPDE4 pubsI
24435818 GRCh37
22689816 NCBI36
1392 
TCTATCAGCTTATTCCTTCTCTACT G → A GAATATTGGTATAGTCAATTCTTAT
- 
 
n=
G/G=
G/A=
A/A=
A=
92
27
16
3
0.239
82
23
10
8
0.317
94
18
19
10
0.415
94
15
20
12
0.468
D76SampleSet

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.